ID: 999918976

View in Genome Browser
Species Human (GRCh38)
Location 5:156297157-156297179
Sequence AATAACTAAGAGAGTATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1886
Summary {0: 1, 1: 0, 2: 33, 3: 567, 4: 1285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999918976_999918977 15 Left 999918976 5:156297157-156297179 CCACTGATACTCTCTTAGTTATT 0: 1
1: 0
2: 33
3: 567
4: 1285
Right 999918977 5:156297195-156297217 AATTGCTAGTTCAACCATTGTGG 0: 1
1: 0
2: 22
3: 55
4: 696
999918976_999918978 27 Left 999918976 5:156297157-156297179 CCACTGATACTCTCTTAGTTATT 0: 1
1: 0
2: 33
3: 567
4: 1285
Right 999918978 5:156297207-156297229 AACCATTGTGGAAGTCAGTGTGG 0: 10693
1: 12096
2: 7438
3: 4425
4: 4285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999918976 Original CRISPR AATAACTAAGAGAGTATCAG TGG (reversed) Intronic
900037394 1:427598-427620 AATAACTGAAAGAGTATAATTGG + Intergenic
900059024 1:663339-663361 AATAACTGAAAGAGTATAATTGG + Intergenic
900863558 1:5251038-5251060 AATAACTAAAAGAGTATAATTGG - Intergenic
901031968 1:6312325-6312347 AATAACTAAAAGAGTGTAAGTGG + Intronic
901161925 1:7184356-7184378 ATTAACTAAAAGAGTATAATTGG + Intronic
901282374 1:8048646-8048668 AATAACTAAAAGAGTATAATTGG + Intergenic
901344958 1:8531912-8531934 AATAACTAAAATAGTATAATTGG + Intronic
901945073 1:12695268-12695290 AATAACTAAAAGAGTATAATTGG - Intergenic
902707922 1:18219179-18219201 AATAAGTCAGAGAGTGACAGGGG + Intronic
902779696 1:18696888-18696910 AATAACTAAAAGAATATAATTGG + Intronic
904850123 1:33452944-33452966 AATAACTAAAAGAGTATACTTGG + Intergenic
905112830 1:35609768-35609790 AATAACTAAAAGAGTATAATTGG + Intronic
905589118 1:39146832-39146854 AATAACTAAAAGAGTTTAATTGG + Intronic
905604783 1:39288175-39288197 AATAACTAAAAGAGTATAACTGG - Intronic
905818811 1:40973464-40973486 AATAACTAAAAGTGTATAATTGG - Intergenic
905988049 1:42305847-42305869 AATAACTAAAAGAGTGTAATTGG + Intronic
906007700 1:42491594-42491616 AATAACTTAAAGAGTATAATTGG + Intronic
906123792 1:43413938-43413960 AATAACTAAAAGAGTAAAATTGG + Intronic
906334878 1:44920387-44920409 AATAACTAAGAGAGTATAATTGG - Intronic
906426582 1:45718990-45719012 AATAACTAGAAGAGTATAACTGG + Intronic
906864239 1:49398848-49398870 AATAACTAAAAGAGTACAATTGG - Intronic
906871639 1:49488551-49488573 AATAACTAAAAGAGTATCATTGG - Intronic
906899207 1:49815024-49815046 AATAACTAAAAGAGTATAATTGG - Intronic
906906440 1:49899111-49899133 AATAACTAAAAGAGTGTAATTGG + Intronic
907131566 1:52101923-52101945 AAAAACTAAAAGAGTATAATTGG + Intergenic
907937598 1:59056812-59056834 AAGAACCAAAAGAGAATCAGAGG - Intergenic
908033190 1:60023355-60023377 AAAAACTAACAGAGCATCACTGG - Intronic
908304630 1:62799771-62799793 AATAACTAAAAGAGCATAACTGG - Intronic
908343490 1:63207168-63207190 AATAACTAAAAGAGTATAATTGG - Intergenic
908428125 1:64028795-64028817 AATAACTAAAAGAGTATAACTGG - Intronic
908496806 1:64702547-64702569 AATAACTAAAAGAGTATAATTGG - Intergenic
908556488 1:65261868-65261890 AATAACTGAAAGAGTATAATTGG + Intronic
908846004 1:68324975-68324997 AATAACTAAAACAGTATAATTGG - Intergenic
908977500 1:69916837-69916859 AAAAACTAAGATATTTTCAGTGG + Intronic
908998649 1:70190814-70190836 AATACCTAATGGAGAATCAGTGG - Intronic
909037052 1:70605339-70605361 AATAACTAAAAAAGTATAATTGG - Intergenic
909210066 1:72811726-72811748 GATAACTAATAGGTTATCAGAGG + Intergenic
909386282 1:75060675-75060697 AATAACTAAAAGAGTATAATTGG + Intergenic
909386298 1:75060965-75060987 AATAACTAAAAGGGTATAATTGG - Intergenic
909386471 1:75063256-75063278 AATAACTATAAGAGTATAATTGG - Intergenic
909509988 1:76441626-76441648 AATAACTAAAAGAGTGTAATTGG - Intronic
909610758 1:77549457-77549479 AATAACTAAAAGACTATAATCGG - Intronic
909878708 1:80845645-80845667 AATAACAAGAAGAGTATCTGAGG + Intergenic
909896942 1:81082945-81082967 AATAACTAAAAGAGTATAATTGG + Intergenic
909945811 1:81662156-81662178 AATAACTTAAAGAGTATAACTGG - Intronic
910385130 1:86674103-86674125 AATAACTAAAACAGTATAATTGG + Intergenic
910592715 1:88944750-88944772 AATACCTAAGGGAGTAGAAGAGG + Intronic
910644431 1:89498189-89498211 AATAACTAAAAGAGTATAATTGG + Intergenic
911001017 1:93165708-93165730 AATAACTAAAAGAGTATAACTGG - Intronic
911012384 1:93294747-93294769 AATAACTGAAAGAGTATAATTGG + Intergenic
911132957 1:94409204-94409226 AATAACTAAAAGAGTACAATTGG + Intergenic
911267889 1:95764416-95764438 AATAACTAAAAGAGTATAATTGG + Intergenic
911283561 1:95961122-95961144 AATAACTAAAAGGGTATAACTGG - Intergenic
911470411 1:98311121-98311143 AATAACTAAAAGAGTGTAATTGG + Intergenic
911487710 1:98523212-98523234 AATAACTAAAAGAGTATTATTGG + Intergenic
911493183 1:98594907-98594929 AATAACTAAAAGATTATTATTGG - Intergenic
911564792 1:99451095-99451117 AATAACTAAAAGAGTATAATTGG + Intergenic
911698111 1:100916609-100916631 AATAACTAAAAGAGTGTAACTGG - Intronic
911853532 1:102849400-102849422 AATAAGTAAAAGAGTATAATTGG + Intergenic
911942481 1:104065396-104065418 AATAACAAAAAGAGTATAATTGG - Intergenic
912068902 1:105782400-105782422 AATAACTAAAAGAGTATAATTGG - Intergenic
912140992 1:106727020-106727042 AATAACTAAAAGAGTATAATTGG + Intergenic
912242951 1:107930162-107930184 AATAACTAAAAGAGTATAACTGG + Intronic
912644379 1:111378173-111378195 AATAACTAAAAGAGTATAATTGG + Intergenic
912736622 1:112154696-112154718 AATAACTAAAAAAGTATGATTGG - Intergenic
912742238 1:112211132-112211154 AATAACTAAAAGAGTATAATTGG + Intergenic
912872300 1:113319532-113319554 AATAACTAAAAGAGTATAAATGG + Intergenic
912898670 1:113623298-113623320 TATAACTAAAAGAGTATAAACGG - Intronic
913166127 1:116187408-116187430 AATAACTAAAAGAGTATAACTGG - Intergenic
913424818 1:118716234-118716256 AATAACTAAAAGAGTGGCATTGG + Intergenic
914895669 1:151669894-151669916 AATTACTAAAAGAGTATAACTGG - Intronic
915179644 1:154047234-154047256 AATAACTAAAAGAGTATAATTGG + Intronic
915186746 1:154112423-154112445 AATAACTAAAATAGTATAACTGG + Intronic
915337878 1:155157896-155157918 AATAAATAAAACTGTATCAGTGG + Intergenic
915693390 1:157714119-157714141 AATAACTAAAATAGTATTATTGG - Intergenic
915791618 1:158678169-158678191 AATAACTAAAAAAGTAGCATTGG - Intronic
916341239 1:163738224-163738246 AATAACTAAAAGAGTATAATTGG - Intergenic
916380308 1:164202509-164202531 AATAACTAAAAGACTATAATTGG + Intergenic
916670703 1:167017120-167017142 AATAACTAAAAGAGAATCATTGG + Intronic
916768412 1:167884108-167884130 AATAACTAAAAGAGTATAATTGG - Intronic
916979708 1:170120722-170120744 AATAACTAAAAGAGTATAATTGG - Intergenic
917044089 1:170837527-170837549 AATAATTAAAAGAGTATAATTGG - Intergenic
917049325 1:170901163-170901185 AATAACTAAAAGAGTATAATTGG + Intergenic
917279398 1:173366614-173366636 AATAACTAAAGGAGTATAATTGG + Intergenic
917300034 1:173563711-173563733 AATAACTAAGAGAGTCTAACTGG - Intronic
917355544 1:174123257-174123279 AATAACTAAAAGAGTATAATTGG + Intergenic
917393967 1:174571406-174571428 AATAACTAAAATAGTATAATTGG + Intronic
917429211 1:174948217-174948239 AATAACTAAAAGAGTATAATTGG + Intronic
917446907 1:175114322-175114344 AATAACTATGGGCATATCAGTGG + Intronic
917524487 1:175774963-175774985 AATAACTAAAAGAGTATAATTGG + Intergenic
917572943 1:176288344-176288366 AATAACTAAAAGAGTATAACTGG - Intergenic
917583330 1:176397889-176397911 AATAACTTAAAGAGTATAATTGG - Intergenic
917740481 1:177957665-177957687 GATAACTAAAAGAGTATAATTGG - Intronic
917820498 1:178758400-178758422 AATAACTAAAAGAGTATAATTGG - Intronic
917864062 1:179176322-179176344 AATAACTAAAAGAGTATAACTGG + Intronic
918065762 1:181100596-181100618 AAGAACGAAGATGGTATCAGTGG - Intergenic
918401505 1:184167353-184167375 AATAACTAAAAGAGTAGAATTGG - Intergenic
918457113 1:184732451-184732473 AACAACTAAAAGAGTATAATTGG + Intronic
918870990 1:189974783-189974805 AATAACTAAAAGAGTAGAATTGG - Intergenic
919047100 1:192466184-192466206 AATAACTAAAAGAGTAAAATTGG - Intergenic
919138040 1:193535212-193535234 AATAACTAAAAGAGTATAATTGG - Intergenic
919252035 1:195067967-195067989 AATAACTAAAAGAGTATAACAGG + Intergenic
919265339 1:195256157-195256179 AATAACTAAAAAAGTATAACTGG + Intergenic
919337247 1:196251734-196251756 AATAACTAAAAGAGTTTAAGTGG + Intronic
919360930 1:196593531-196593553 AATAACTAAAAGAGTATAATCGG + Intronic
919412077 1:197258156-197258178 AATAACTAAAATAGTATAATTGG + Intergenic
919456115 1:197820948-197820970 AATAACTGAAAGAATATCACTGG + Intergenic
919477604 1:198048690-198048712 AATAACTAAAAGAGTATAATTGG - Intergenic
919532164 1:198736194-198736216 AATAACCAAAAGAGTATAACTGG - Intronic
920271153 1:204764842-204764864 AATAACTAAAAGAGTATAACTGG - Intergenic
920550200 1:206854223-206854245 AATAACTAGAAGAGTATAACTGG + Intergenic
920592945 1:207239710-207239732 AATAACTAAAAGAGTATAATTGG + Intergenic
920594200 1:207252105-207252127 AATAACTAAAAGAGTATAATTGG - Intergenic
920721278 1:208389334-208389356 AAAAACTAAAAGAGTATAATTGG - Intergenic
920923370 1:210317916-210317938 AATAACTAAAAGAGTAGAATTGG - Intergenic
921066858 1:211629583-211629605 AATAACTAAAAGCGTATAATTGG + Intergenic
921176356 1:212598468-212598490 AATAACTAGAAGAGTATAATTGG - Intronic
921241595 1:213189657-213189679 AATAACTAAAAGAATATAACTGG - Intronic
921416494 1:214893882-214893904 AATAACTAAAAGAGTATGATTGG + Intergenic
921979600 1:221241507-221241529 AATAACAAAGAGGGAAACAGAGG - Intergenic
922010552 1:221580421-221580443 AAAAACTAAAAGAGTATAATTGG + Intergenic
922044846 1:221935502-221935524 AATAACTAAAAGAGTATAACTGG + Intergenic
922387410 1:225101364-225101386 AATAACTAAAAGATTATCATTGG - Intronic
922596647 1:226818934-226818956 AATAACTAAAAGAATATAATTGG + Intergenic
922642666 1:227249936-227249958 AATAACTAAAAGAGTACAACTGG + Intronic
922704762 1:227784108-227784130 AATTACTAAAAGAGTATAATTGG - Intergenic
923058780 1:230451246-230451268 AATAACTAAAAGAATATAATTGG + Intergenic
923072684 1:230580264-230580286 AAGAACTAAAAGAGTATAATTGG - Intergenic
923393869 1:233541607-233541629 AATAACAAAGAGAGTAGAATTGG + Intergenic
923691220 1:236195115-236195137 AATAACTAAAAGAGTGTGATTGG - Intronic
923817060 1:237392305-237392327 AATAACTAAAAGAGTGTAACTGG + Intronic
923960547 1:239077892-239077914 ACTAACTAAAAGAGTATGATTGG + Intergenic
924038992 1:239964973-239964995 AATGAGTAAGTGTGTATCAGTGG + Intergenic
924112106 1:240710465-240710487 AATAACTAAAAGAGTATAATTGG - Intergenic
1063118779 10:3089602-3089624 AATAACTAAAAGAGTAAAATTGG - Intronic
1063251281 10:4278047-4278069 AACAACTAAGAGATTATAAAAGG + Intergenic
1063641256 10:7832883-7832905 AATAACTAAAAGAGTATAACTGG - Intronic
1063777111 10:9275639-9275661 AAAAACTGAGAGAGTATCCATGG - Intergenic
1063836177 10:10015997-10016019 GATAACTTAGAGAGTATAATTGG - Intergenic
1064012567 10:11746457-11746479 ACTAACTAAAAGAGTATCATTGG + Intronic
1064331536 10:14398703-14398725 AATAGCTAAAAGAGTATAATTGG + Intronic
1064333225 10:14414149-14414171 AATAACTAAAAGACTATAACTGG + Intronic
1064336985 10:14452547-14452569 AATAACTAAAAGAGTGTAATTGG + Intronic
1064387457 10:14909508-14909530 AATAAATGCCAGAGTATCAGTGG + Intronic
1064463458 10:15556712-15556734 AATAACTAAAAGAGCATAATTGG - Intronic
1064699262 10:18001827-18001849 AATAACTAAAAGAGTATAATTGG - Intronic
1064724465 10:18264326-18264348 AATAACTAAAAGGGTATAATTGG - Intronic
1064783784 10:18871530-18871552 AATAACTAAAAGAGTACAAATGG - Intergenic
1064846257 10:19657697-19657719 AATAGCTAACAGAGTATAATTGG - Intronic
1064956073 10:20911631-20911653 TATAAATAAGAAAGTATAAGTGG + Intronic
1064979865 10:21155285-21155307 AATAACTAATAGAATATAATTGG - Intronic
1065069972 10:22013563-22013585 AATAACTTAAAGAGTATAATTGG - Intergenic
1065197708 10:23283047-23283069 AATAACTAAAAGAGTATAAATGG + Intronic
1065213259 10:23424801-23424823 AATAACTAAAAGAGTATAACTGG - Intergenic
1065257040 10:23880587-23880609 AATAACTAAAAGAGTATAGCTGG + Intronic
1065380887 10:25088807-25088829 AATAACAAAAAGAGTATAATTGG - Intergenic
1065431090 10:25656685-25656707 AATATCTAAAAGAGTATAATTGG - Intergenic
1065517160 10:26535461-26535483 AATAACTAAAAGAGTGTAATTGG - Intronic
1065609037 10:27452551-27452573 AATAACTAAAAGAGTATAATTGG - Intergenic
1065742015 10:28805531-28805553 AATAACTAAAAGAGTATAATTGG - Intergenic
1065876904 10:30005051-30005073 AATAACTAAAAAAGTATAATTGG - Intergenic
1065907157 10:30266439-30266461 AATAACTAAAAGAGTATAACTGG + Intergenic
1066142429 10:32519729-32519751 AATAACTAAAAAAGTATAACTGG - Intronic
1066144928 10:32547752-32547774 AACAACTAAGAAAGTATAATTGG - Intronic
1066148532 10:32589014-32589036 AATAACTAAGAAAGTATAATTGG - Intronic
1066178209 10:32932914-32932936 AATAACTAAAAGAGTATAATTGG - Intronic
1067197205 10:44132450-44132472 AAGCACCAAGAGTGTATCAGGGG + Intergenic
1067977061 10:51038331-51038353 AATAACTAAAAGAGAATAATTGG - Intronic
1068002666 10:51354292-51354314 AATAACTAAAAGAGTATAATTGG + Intronic
1068272435 10:54746449-54746471 AATAACCAAAAGAGTATAAGTGG + Intronic
1068297096 10:55085471-55085493 AATAACTAAAAGAGTATAATTGG + Intronic
1068362665 10:55998968-55998990 AATAACTACAAGAGTATAATCGG + Intergenic
1068445101 10:57110605-57110627 AATAACTAAAAGAGTATAATTGG + Intergenic
1068556209 10:58462182-58462204 AATAAATAAAAGAGTATAATTGG - Intergenic
1069051058 10:63794793-63794815 AATAACTAAAAGAGTATAATTGG + Intergenic
1069148203 10:64922590-64922612 AATAACTAAAAGAGTGTAATTGG + Intergenic
1069214378 10:65801164-65801186 AATAACTAATACAATATTAGTGG + Intergenic
1069345942 10:67469946-67469968 AATAACTAAAAGAGTATAATTGG - Intronic
1069655094 10:70081830-70081852 AATAGCTAAAAGAGTATAATTGG + Intronic
1070080413 10:73180760-73180782 AATAACTAAAAGAGTGTAATTGG - Intronic
1070579328 10:77707969-77707991 AATAACTAAAAGATTATAATTGG + Intergenic
1070870487 10:79747326-79747348 AATAACTAAAAGAGTATAATGGG + Intergenic
1070939681 10:80333426-80333448 AAGAACTAAAAGAGTATAACTGG + Intergenic
1071050550 10:81443270-81443292 AATAACTAAAAGAGTATAACTGG - Intergenic
1071053129 10:81474973-81474995 AATAACTAAAACAGTATAATTGG + Intergenic
1071088556 10:81892803-81892825 AATAACTAAAAGAATATAATTGG + Intronic
1071255999 10:83872162-83872184 AATAACTAAAAGAGTATAATTGG - Intergenic
1071451957 10:85803216-85803238 AATAACTAAAAGAGTATAATTGG + Intronic
1071667469 10:87574581-87574603 AATAACTAAAAGAGTATAATTGG - Intergenic
1071691341 10:87822773-87822795 AATAACTAAAAGAGTATAATTGG + Intronic
1071825975 10:89326571-89326593 AATAACTAAAAGAGTATAATTGG + Intronic
1071896139 10:90068865-90068887 AATAACTAAAAGAATATAACTGG - Intergenic
1072138170 10:92566734-92566756 AATAACTAAAAGAGTTTAATTGG + Intronic
1072331748 10:94360684-94360706 AATAACTAAAAAAGTATAACTGG + Intronic
1072343731 10:94481957-94481979 AATAACTAAAAGATTATAATTGG - Intronic
1072477932 10:95781429-95781451 AATAACTAAAAGAGTATAATTGG + Intronic
1072510652 10:96120821-96120843 AATAACTAAAAGAGTATAATTGG - Intergenic
1072520888 10:96229090-96229112 AATAACTAAAAGAATATAATTGG - Intronic
1072732954 10:97860282-97860304 AATAACTAAAAGAGTATAACTGG - Intronic
1072843808 10:98805358-98805380 AATAGCTAAAAGAGTATAATTGG + Intronic
1073132594 10:101199715-101199737 AAAAACTAAAAGAATATAAGTGG + Intergenic
1073854263 10:107656571-107656593 AAAAAAAAAGAGAGTCTCAGAGG + Intergenic
1074017897 10:109553217-109553239 AATAACTAAAAGAATATAATTGG - Intergenic
1074301488 10:112237123-112237145 AATAACTAGAAGAGTATAATTGG - Intergenic
1075196413 10:120363206-120363228 AATAACTAAAAGAGTGTAATTGG + Intergenic
1075885325 10:125895503-125895525 AACAACCAGGAGAGTATCATAGG - Intronic
1076377189 10:129999130-129999152 AATAACTAAAAGAGTACAATTGG + Intergenic
1076456315 10:130601028-130601050 GATAACTAAAAGAGTATAATTGG - Intergenic
1076964120 11:65521-65543 AATAACTGAAAGAGTATAATTGG + Intergenic
1077699036 11:4422847-4422869 AATAACTAAAAGAGTGTAATTGG - Intergenic
1077859805 11:6166985-6167007 AATAAATAAAAGAGTATAATTGG + Intergenic
1077912888 11:6588160-6588182 AATAACTAAAGGAGTATGATTGG + Intronic
1077959070 11:7053806-7053828 AATAACTAAAAGAGTATACTTGG - Intronic
1078037214 11:7819690-7819712 AATAACTAAAAGAGTATAATTGG + Intergenic
1078127329 11:8580606-8580628 AATAACTTAAAGAGTATAAATGG + Intronic
1078164106 11:8867899-8867921 AAGAAATAAGAGAATATGAGAGG + Intronic
1078243590 11:9552585-9552607 AAAAACTAAAAGAGTATAATTGG - Intergenic
1078750730 11:14160026-14160048 AATAACTTAAAGAGTATAATTGG + Intronic
1079068542 11:17321104-17321126 AATAACTAAAAGAGTATAATTGG - Intronic
1079166576 11:18049645-18049667 AATAACTAAAAGAATATAATAGG + Intergenic
1079186115 11:18238665-18238687 AATAACCAAAAGAGTATAATTGG - Intergenic
1079482933 11:20901631-20901653 AATAACTAAGACATTTTCTGAGG + Intronic
1079530304 11:21444735-21444757 AATAACTAGAAGAGTATAATTGG - Intronic
1079566098 11:21885211-21885233 AATAACTACAAGAGTATGATTGG + Intergenic
1079687408 11:23376998-23377020 AATAACTGAAAGAGTATAATTGG + Intergenic
1079829119 11:25238975-25238997 AATAACTTAAAGAGTATAATGGG + Intergenic
1080351657 11:31392235-31392257 AATAACTAAAAGAGTTTAATTGG + Intronic
1080838411 11:35961899-35961921 AATAACTAAAAGAGTATAATTGG - Intronic
1081006596 11:37751994-37752016 AATAACTAAGAGAGTATAATTGG + Intergenic
1081422670 11:42889883-42889905 AATAACTAGAAGAGTATAATTGG + Intergenic
1081463958 11:43299412-43299434 AATAACTAAAAGAGTATAATTGG + Intergenic
1081999316 11:47384616-47384638 AATAACTAAAAGAATATAATTGG - Intergenic
1082111065 11:48274695-48274717 AATAACTAAAAGAGTGTAAGTGG - Intergenic
1082132308 11:48505874-48505896 AATAACTAAAAGAGTATAAGTGG + Intergenic
1082244506 11:49905566-49905588 AATAACTAAAAGAGTGTAAGTGG - Intergenic
1082565773 11:54676494-54676516 AATAACTAAAAGAGTATAAGTGG + Intergenic
1082637044 11:55609041-55609063 AATAACTTAAAGAGTATAACTGG - Intergenic
1083506074 11:63158603-63158625 AATAACTAAAGGAGTATAACTGG - Intronic
1083506084 11:63158757-63158779 AATAACTAAAAAAGTATAATTGG - Intronic
1083512227 11:63220622-63220644 AATAACTAAAAGAGTATAATTGG - Intronic
1083957237 11:65991216-65991238 AAAAACAAAGGGAGTATAAGTGG + Intergenic
1084763253 11:71287763-71287785 AATAGCTAAAAGAGTATAATTGG - Intergenic
1085106972 11:73853227-73853249 AATAACTAAAAGAGTATAGTTGG + Intronic
1085256897 11:75179703-75179725 AACAACTAAGAGAGTATAATTGG - Intronic
1085553536 11:77398120-77398142 AATAACTAAAAGACTATAATTGG - Intronic
1085562504 11:77485302-77485324 AATAACTAAAAGAGTATAATTGG + Intergenic
1086032709 11:82379550-82379572 AGTAACTAAAAGAGTATAATTGG + Intergenic
1086184427 11:83996951-83996973 AATAACAAAAAGAGTATAATTGG + Intronic
1086231490 11:84575687-84575709 AATAATGAAAAGAGTATAAGTGG - Intronic
1086233498 11:84598598-84598620 AGTAACTAAAATATTATCAGAGG - Intronic
1086280476 11:85181336-85181358 AATAACTAAAAGGGTGTAAGTGG - Intronic
1086309976 11:85524227-85524249 AATAACTAAAAGAGTATAACTGG + Intronic
1086515534 11:87607928-87607950 AATAACTCAAAGAGTATAATTGG + Intergenic
1086759231 11:90606430-90606452 AATAACTAAAAGAGTATAACTGG - Intergenic
1086792158 11:91055145-91055167 AATAACTAAGAGACTATAATTGG + Intergenic
1087009142 11:93496974-93496996 TTAATCTAAGAGAGTATCAGAGG + Intronic
1087068509 11:94050669-94050691 AATAACGAAAAGAGTATAATTGG - Intronic
1087070707 11:94077534-94077556 AATAACTAAAAGAATATAAATGG - Intronic
1087088405 11:94243260-94243282 AATAACTAAAAGAGTATAATTGG + Intergenic
1087345618 11:96967100-96967122 AATAACTAAAAGAGTATAGTTGG + Intergenic
1087435323 11:98109990-98110012 AATAACTAAAAAAGTATAATCGG + Intergenic
1087497080 11:98905744-98905766 AATAACTGAAAGAGTATAATTGG - Intergenic
1087509930 11:99078927-99078949 AATCACTAAAAGAGTATAAGTGG + Intronic
1088256734 11:107910266-107910288 AAAAACTAAAAGAGTATAATTGG - Intronic
1088386963 11:109269278-109269300 AATAACTAAAAAAGTATAAACGG - Intergenic
1088406531 11:109485891-109485913 AATAAATAAAAGAGTATAATTGG + Intergenic
1088491524 11:110393002-110393024 AATAACTAAAAGAGTGTCATTGG - Intergenic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1089371165 11:117959277-117959299 AATAACTAAAAGTGTATGATTGG + Intergenic
1089717529 11:120376657-120376679 AATAACTAGAAGAGTATAATTGG - Intronic
1089718593 11:120389612-120389634 AATAACTAAAAGAGTACAACTGG - Intronic
1089761538 11:120728762-120728784 AATAACTAAAAGAGTTTAATTGG - Intronic
1089947016 11:122486599-122486621 AATAACTGAAAGAGTATAATTGG + Intergenic
1090137848 11:124217810-124217832 AATAACTAAAAGGGTATAATTGG - Intergenic
1090281219 11:125457779-125457801 AATAACTAAAAGAGTATAATTGG - Intronic
1090442779 11:126737875-126737897 AATAACTAAAAGAGTAGAATTGG - Intronic
1090691474 11:129187509-129187531 AATAATTAAAAGAGTATAATTGG + Intronic
1091158288 11:133394411-133394433 AATAACCAAAAGAGTATAATTGG - Intronic
1091371459 11:135063609-135063631 TATAGCTCAGAGAATATCAGTGG - Intergenic
1091598846 12:1904354-1904376 AATAACTAAAAGAGTATAATTGG + Intronic
1091758054 12:3068346-3068368 AATAACTGAGATAGAAACAGTGG - Intergenic
1091966557 12:4747220-4747242 AATAACTAAAAGAATATAATTGG - Intronic
1092099030 12:5868046-5868068 AATAACTAAAAGAGTACAATTGG + Intronic
1092298190 12:7219197-7219219 AATAACTAAAAGAATATCACTGG - Intergenic
1092329743 12:7573321-7573343 CAAAACTAGGAGAGTATCAATGG - Intergenic
1092476647 12:8824500-8824522 AATTACTAAGAGAGTATAATTGG - Intronic
1093397279 12:18698783-18698805 AATAACTAAAAGAGTATAATTGG - Intronic
1093416397 12:18925648-18925670 AATAACTAAAAGAGTATAATTGG - Intergenic
1093531364 12:20168660-20168682 AATAACAAAAAGAGTATAATTGG - Intergenic
1093532778 12:20186995-20187017 AATAACAAAGAGGGCATCTGTGG + Intergenic
1093563678 12:20576148-20576170 AATAACTAAAAGAGTATAATTGG - Intronic
1093569490 12:20650149-20650171 AATAACTAAAAGAGTATAACTGG - Intronic
1093697577 12:22179273-22179295 AATAACTAAAAGAGTGTAATTGG + Intronic
1093724097 12:22483022-22483044 AATAACTAAAAGAGTATAACAGG + Intronic
1093887694 12:24481404-24481426 AATAACTAAAAGAGTATAATTGG + Intergenic
1093987255 12:25549574-25549596 AATAAATAAGAAAGTAAAAGTGG + Intronic
1094096318 12:26708740-26708762 AATAACTAAAAGAGTAGAATTGG + Intronic
1094134460 12:27109271-27109293 AATAACTAAAAGAATATAATTGG - Intergenic
1094199055 12:27779420-27779442 AATAACTTAGGGAGAATAAGGGG + Intergenic
1094271304 12:28619374-28619396 AATAACTGAAAGAGTATAATTGG + Intergenic
1094285521 12:28788774-28788796 AATAACTAAAAGAGCATAATTGG + Intergenic
1094534999 12:31313430-31313452 AGTAATTAAGATAGTATTAGTGG - Intronic
1094782549 12:33808592-33808614 AATAACTAAAAGAGTATAATTGG + Intergenic
1094815112 12:34175520-34175542 AAAAACTAAAAGAGTATAATTGG - Intergenic
1095241359 12:39862862-39862884 AATAACTAAAAGAGTAGAATTGG - Intronic
1095432912 12:42153395-42153417 AATAACTAAAAGAGTATAATTGG + Intergenic
1095466523 12:42493207-42493229 AATAACTAAAAGAGTATAACTGG + Intronic
1095556256 12:43508764-43508786 AATAACTAAAAGAGTATAATTGG - Intronic
1095668186 12:44827305-44827327 AATAACTAAAAGAGTATAATGGG - Intronic
1095760669 12:45831529-45831551 AATAACTAAAAATGTATAAGTGG - Intronic
1096449931 12:51730709-51730731 AATAACTAAAAGAATATAACTGG - Intronic
1096631671 12:52930898-52930920 TCAAACTAAGAGAGAATCAGTGG - Intronic
1096637288 12:52968332-52968354 AATAACTAAAAGAGTATAATTGG + Intergenic
1096891123 12:54772555-54772577 AATAACTAAAAGAGTATAATTGG - Intergenic
1096930580 12:55204286-55204308 AATAACTAAAGGAGTATAACTGG + Intergenic
1097257431 12:57690102-57690124 AATAACTAAAAGGGTATAATCGG - Intergenic
1097296205 12:57965700-57965722 AATAACTAAAAGTGTATAATTGG + Intergenic
1097425350 12:59437443-59437465 AATAACTAAAAGGGTATAATTGG - Intergenic
1097631283 12:62066288-62066310 AATAACTAAAAGAGTATAATTGG - Intronic
1097656945 12:62377202-62377224 AATAACTAAAAGAGCATAATTGG - Intronic
1097714170 12:62947987-62948009 AATAACTAAAAGAATATAATTGG - Intergenic
1097756468 12:63412418-63412440 AATAACTAAAATAGTATAATTGG - Intergenic
1097770456 12:63578442-63578464 AATAACTGAGAGAGTATAACTGG + Intronic
1097943634 12:65341552-65341574 AAAAACTAAAAGAGTATAATTGG + Intronic
1098047739 12:66419434-66419456 AATAACTAAAAAAGTATAATTGG + Intronic
1098060897 12:66561314-66561336 AATAACTAAAAGAGTATAATTGG + Intronic
1098113618 12:67151059-67151081 AATAACTAAAAGAGTATAATTGG - Intergenic
1098240162 12:68458806-68458828 AATAACTAAAAGAGTATAATTGG + Intergenic
1098332784 12:69372341-69372363 AATAACTAAAAGAGTATATTTGG - Intronic
1098396499 12:70023916-70023938 AATAACTAAAAGAATATAATTGG + Intergenic
1098427975 12:70387825-70387847 AATAACTTAAAGAGTATAACTGG - Intronic
1098582364 12:72115092-72115114 AATAACTTAAAGAGTATAACTGG - Intronic
1098935923 12:76479195-76479217 AATAACTAAATGAGTATAATTGG + Intronic
1099125359 12:78748777-78748799 AATAACTAAAAGAGTATAATTGG + Intergenic
1099237599 12:80100237-80100259 AATAACTAAAAGAGTAGAATTGG - Intergenic
1099271591 12:80517509-80517531 AATAACTAAAAGAGTATAATTGG - Intronic
1099616487 12:84942023-84942045 AATAACTAAAAGAGTATAATTGG + Intergenic
1099763669 12:86954219-86954241 AATAACTAGAAGAGTATAATTGG - Intergenic
1100300063 12:93298654-93298676 AATAACTAAAAGAGCATAATTGG + Intergenic
1100480647 12:94974998-94975020 AACAACTAAAAGAGTATAATTGG + Intronic
1100489516 12:95065621-95065643 AATAACTAAAAGAGTATAATTGG - Intronic
1100722127 12:97370326-97370348 AATAACTAGAAGAGTATAATTGG + Intergenic
1100905616 12:99294935-99294957 AATAACTAAAAGAATATAATTGG + Intronic
1100910864 12:99361106-99361128 AATAACTAAAAGAGTGTAATTGG + Intronic
1101025638 12:100602646-100602668 AATAACTAAAAGAGTACAATTGG - Intronic
1101117542 12:101546939-101546961 AATAACTAAAAGAGTAGAATTGG + Intergenic
1101317784 12:103644791-103644813 AATAACTGAAAGAGTATAATTGG + Intronic
1101379099 12:104198528-104198550 AATAACTAAGAGAGTTTAACTGG + Intergenic
1101461032 12:104893985-104894007 AATAACTACAAGAGTATAATTGG + Intronic
1101480808 12:105095186-105095208 AATAACTAAGAGAGTATAGTTGG - Intergenic
1101553238 12:105783144-105783166 AATAACTAAAAGAGAATAATTGG - Intergenic
1101608199 12:106266312-106266334 AATAACTAAAAGAGTGTGATTGG + Intronic
1101951652 12:109180825-109180847 ATTAACTAAAAGAGTATAATTGG - Intronic
1102318616 12:111911511-111911533 AATAACTAAACGAGTATAACTGG + Intergenic
1102552165 12:113699299-113699321 AATAACTAAAAGAGTATAACTGG + Intergenic
1103207298 12:119140039-119140061 AATAACTAAAAGAGTGTAATTGG - Intronic
1103219160 12:119229163-119229185 AGGAAGTCAGAGAGTATCAGGGG + Intergenic
1103666457 12:122570592-122570614 AATAACTAAAAGAGTGTAATTGG + Intronic
1103833035 12:123795850-123795872 AGTAACTAAAAGAGTATAATTGG + Intronic
1104084243 12:125459655-125459677 AATAACTAGAAGAGTATAATTGG + Intronic
1104102594 12:125627668-125627690 AATAACTAGAAGAGTATAACTGG - Intronic
1104318829 12:127730691-127730713 AATAACTGAAAGAGTATAATTGG + Intergenic
1104446558 12:128838453-128838475 AATAATTAAAAGAGTATAATTGG + Intergenic
1104524734 12:129509479-129509501 AATAACTAAAAGAATATAATTGG - Intronic
1104888731 12:132128307-132128329 AATAAGCAAGAGAGTATCAGAGG + Intronic
1105059258 12:133133589-133133611 ACTATCTCAGAGAGGATCAGTGG - Intronic
1105313831 13:19238025-19238047 AATAACTAAAAGAGTGTAATCGG + Intergenic
1105459925 13:20574966-20574988 AATAACTAAAAGAATATAATCGG - Intronic
1105529945 13:21210100-21210122 AATAACTAAAAGAGTATAACTGG - Intergenic
1105614184 13:21997559-21997581 AATAACTGAGGGAGTACAAGTGG - Intergenic
1105619620 13:22054096-22054118 AATAACTAAAAGAGTATAATTGG + Intergenic
1105936869 13:25108566-25108588 AATAACTAAAAGAGTACAATGGG - Intergenic
1106075300 13:26455484-26455506 AATAACCAAAAGAGTATAATTGG + Intergenic
1106152144 13:27115175-27115197 ACTTACTAAGAGACCATCAGAGG - Intronic
1106676536 13:31965394-31965416 AATAACTAAAAGAGTATAACTGG - Intergenic
1106792535 13:33170140-33170162 AATAACTAAAAGAGTATAATTGG + Intronic
1106984424 13:35328483-35328505 AATAACTAAAGGAGTATAATTGG + Intronic
1107020787 13:35748727-35748749 AATAACTAAGAGAATATAATTGG - Intergenic
1107033623 13:35878644-35878666 AATAACTAAAAGAGTATAATTGG + Intronic
1107224073 13:38025970-38025992 AATAACTAAAAGAGTTTAATTGG - Intergenic
1107265432 13:38547887-38547909 AATAACTTAAAGAGTGTAAGTGG - Intergenic
1107578541 13:41754605-41754627 AATAACTAGAAGAGTATAATTGG - Intronic
1107643577 13:42470563-42470585 AATAACTAAAAGAGTATAATGGG + Intergenic
1107653227 13:42565976-42565998 AATAACACAGAGAGTATGTGGGG + Intronic
1108045763 13:46382979-46383001 AATAACTGATAGAATGTCAGTGG + Intronic
1108171106 13:47742985-47743007 AATAACTAAAAGAATATAATTGG + Intergenic
1108252383 13:48580099-48580121 AATAACTAAAAGAGTATAGTTGG + Intergenic
1108443989 13:50487612-50487634 AATAACTAACAGAGTATAACTGG - Intronic
1108566644 13:51705732-51705754 AATAACTAAAAGAGTATAATTGG - Intronic
1108695980 13:52902727-52902749 CATGACAGAGAGAGTATCAGAGG + Intergenic
1108878664 13:55081549-55081571 AATAACTAAAAGAGCATAAGTGG - Intergenic
1108973728 13:56409588-56409610 AATAAATAAAAGAGTATTATTGG + Intergenic
1109382384 13:61580618-61580640 AATAACAAAGATATTATCAAAGG - Intergenic
1109480075 13:62941030-62941052 AATAACTAAAAGAGTATAATCGG + Intergenic
1109536209 13:63723101-63723123 AATAACTAAAAGAGTATAATTGG + Intergenic
1109539891 13:63763185-63763207 AATAACTAAAAGAGTATAATTGG - Intergenic
1109631074 13:65046924-65046946 AATAACTAAAAGACTATAATGGG - Intergenic
1109893005 13:68643219-68643241 CCTTCCTAAGAGAGTATCAGTGG + Intergenic
1109927439 13:69162867-69162889 AATAACTAAAACAGTATTATTGG - Intergenic
1110203653 13:72883964-72883986 AATAACTAAAAGAGTATAATTGG + Intronic
1110248064 13:73350160-73350182 AATAACAAAGAGTAAATCAGAGG + Intergenic
1110271224 13:73593013-73593035 AATAACTAAAAGAGTGTAATCGG + Intergenic
1110453517 13:75663988-75664010 AATAACTGAAAGAGTATAATTGG - Intronic
1110472090 13:75871750-75871772 AATAACTAAGAGAGTAGAATTGG - Intronic
1110840687 13:80138908-80138930 AATAAATAAGACATTATCTGTGG - Intergenic
1110960639 13:81619775-81619797 AATAACTAAAAGAATATAATTGG + Intergenic
1111022289 13:82467640-82467662 AATAACTAAAAGAGTATAATTGG - Intergenic
1111354643 13:87082072-87082094 AATAACTAAAAGAGTAGAATTGG + Intergenic
1111422642 13:88035150-88035172 AATAACTAAAAGAATATAATTGG - Intergenic
1111512596 13:89286727-89286749 AATAACTAAAAGAGTAACATTGG - Intergenic
1111729044 13:92050062-92050084 AATAACTAAGAAAGAAACACAGG + Intronic
1111830609 13:93324410-93324432 AATAACTAAAAGAGTATAATTGG + Intronic
1111837020 13:93400584-93400606 AATAACTAAAAGAGTATAATTGG + Intronic
1112465894 13:99644516-99644538 AATAACTACAAGAGTATAACTGG - Intronic
1112720645 13:102240687-102240709 AATGACTAAAAGAGTATAATTGG + Intronic
1112863189 13:103860455-103860477 AATAACTAAAAGAGTAGAATTGG - Intergenic
1112904268 13:104397865-104397887 AATAACTAAAAGAATATAACTGG - Intergenic
1112915503 13:104545120-104545142 AATAACTTAAAGAGTATAATTGG - Intergenic
1113259350 13:108544532-108544554 AATAACTGAAAGAGTATAATTGG - Intergenic
1113261035 13:108563334-108563356 AATAACTAAAATAGTATAATTGG - Intergenic
1113403403 13:110016554-110016576 AATAACTAAAAGAGTATAATTGG + Intergenic
1114159689 14:20150580-20150602 AATAACTAAAAAAGTATAATTGG + Intergenic
1114248857 14:20940189-20940211 AATAACTAAAAGAGTATGATTGG - Intergenic
1114346227 14:21798164-21798186 AATAACTAAAAGTGTATAATTGG - Intergenic
1114747302 14:25163443-25163465 AATAACTAAAAGAGTATAATTGG - Intergenic
1114761094 14:25315446-25315468 AATAACTGAAAGAGTATAATTGG - Intergenic
1114878043 14:26747785-26747807 AATAACTAAAAGAGTATAATTGG + Intergenic
1114997361 14:28373011-28373033 AATAACTGAAAGAGTATAATTGG + Intergenic
1115096711 14:29646369-29646391 AATAACTAGAAGAGTATAATTGG + Intronic
1115125852 14:29992863-29992885 AATAACTAAAAGAGTATAATAGG + Intronic
1115188654 14:30722370-30722392 AATAATTAAAATAGCATCAGGGG + Intronic
1115200089 14:30843822-30843844 AATAACTAAAGGAGTATAATTGG - Intergenic
1115276337 14:31613433-31613455 AATAACTAAGAGAGTGTAATTGG + Intronic
1115329347 14:32178438-32178460 AATAACTTAAAGAGTATAATTGG - Intergenic
1115381024 14:32739378-32739400 AATAACTAAAAAAGTATAATTGG - Intronic
1115397640 14:32926707-32926729 AATAACTAAAAGACTATGACTGG + Intergenic
1115661836 14:35502935-35502957 AATAACTAAAATAGTATAATTGG + Intergenic
1115678485 14:35709208-35709230 AATAACTAAAAGAATATAATTGG + Intronic
1115809555 14:37091803-37091825 AATAACTCAGAGGCTTTCAGTGG - Intronic
1115861893 14:37695683-37695705 AATAACTGAAAGAGTATAATTGG + Intronic
1115918927 14:38349951-38349973 AATAATTAAAAGAGTATAATTGG + Intergenic
1115924907 14:38421601-38421623 AATAACTAAAAGAGTACAATTGG - Intergenic
1115949339 14:38702146-38702168 AATAACTAAAAGAATATAATTGG + Intergenic
1116026031 14:39516450-39516472 AATAACTAAAAGAGTATAATTGG + Intergenic
1116045857 14:39741539-39741561 AATAACTAAAAGAGTATAATTGG - Intergenic
1116140169 14:40983255-40983277 AATAACTAAAAGAGTATAACTGG - Intergenic
1116193356 14:41688297-41688319 AACAACTAAGAGAGTATAGTTGG + Intronic
1116257735 14:42578563-42578585 AATAACTAAAAGAGTATAATTGG + Intergenic
1116393972 14:44426124-44426146 AATATCTAAAAGAGTATAATTGG + Intergenic
1116422476 14:44748939-44748961 AATAACTAAAAGAGTATAACTGG + Intergenic
1116434811 14:44885151-44885173 AATAACTAAAAGAGTGTAATTGG + Intergenic
1116458357 14:45144185-45144207 AATAACTAAAAGAGTATAACTGG - Intronic
1116489384 14:45488210-45488232 AATAACTAAAAGAGTATAATTGG - Intergenic
1116497275 14:45576614-45576636 AATAACTAAAGGAGTATAATTGG - Intergenic
1116547786 14:46191981-46192003 AATAACTAAAAGAGTATAATTGG + Intergenic
1116650842 14:47590643-47590665 AATAACTAAAAGATTATAATTGG + Intronic
1116802999 14:49463151-49463173 AATAACTAAAAGAGTAGAATTGG - Intergenic
1116810237 14:49532954-49532976 AATAACTGAAAGAGTATAACTGG + Intergenic
1117021442 14:51574807-51574829 AATAACTAAAAGAATATAATTGG + Intronic
1117158640 14:52965704-52965726 AATAGCTAAAAGAGTATAATTGG - Intergenic
1117160987 14:52989370-52989392 AATAACTAAAAGAGTATAATTGG - Intergenic
1117234321 14:53755096-53755118 AATAACTAAAAGAGTATGATTGG + Intergenic
1117503930 14:56381840-56381862 AGTAACTAAAAGAGTATAATTGG - Intergenic
1117509413 14:56433896-56433918 AATAACTAAAAGAGTATAATTGG - Intergenic
1117528848 14:56639293-56639315 AATAACTAAAAGAGTATAATTGG + Intronic
1118022523 14:61733052-61733074 AATAACCAAAAGAGTATAACTGG - Intronic
1118115107 14:62766814-62766836 AATAACTAAAAGAGTGTAACTGG + Intronic
1118228411 14:63925508-63925530 AATAACTTACAGAGTATAACTGG - Intronic
1118425624 14:65657803-65657825 AATAACTAAAAGAGTATAATTGG + Intronic
1118534823 14:66749998-66750020 AATAACTAAAAGAGTATAAATGG - Intronic
1118538496 14:66795839-66795861 AATAACTAAAAGAGTATAATTGG - Intronic
1118591191 14:67402428-67402450 AATAACCAAAAGAGTATAATCGG - Intronic
1118740053 14:68732871-68732893 AATAACGAAAAGAGTATAATTGG + Intergenic
1119109057 14:71954581-71954603 AATAACTAAAAGAGTGTAATTGG - Intronic
1119361838 14:74056651-74056673 AATAACTAAAAGAGTGTAATTGG + Intronic
1120026323 14:79588935-79588957 AATAACTAAAAGGGTATAATTGG - Intronic
1120137094 14:80883032-80883054 AATAACTAAAAGAGTATAATTGG + Intronic
1120227492 14:81807797-81807819 TATATCTCAGAGAGTGTCAGAGG - Intergenic
1120627568 14:86847761-86847783 AATAACTAGAAGAGTATAATTGG + Intergenic
1120668988 14:87342242-87342264 AATAACTAAAAGAATATGATTGG + Intergenic
1120736633 14:88060330-88060352 AATAACTAAAAGAGTATAACTGG + Intergenic
1120822267 14:88922921-88922943 AATAACTAAGAGAGTATAACTGG - Intergenic
1120940949 14:89948967-89948989 AATAACCAAAAGAGTATAATTGG + Intronic
1121177606 14:91902815-91902837 AATATTTAAGAGAGTCTAAGAGG + Intronic
1121760070 14:96437194-96437216 AATAACTTAAAGAGTATAATTGG + Intronic
1122016528 14:98801518-98801540 AATAACTAAAAGAGTGTAATTGG - Intergenic
1122187712 14:100014037-100014059 AATAACTAAAAGAGTATAACTGG - Intronic
1122436159 14:101701417-101701439 AATAACTAAAAGAGTATAATTGG + Intergenic
1123137884 14:106046655-106046677 AATAACTAAAAGTGTATAAATGG - Intergenic
1123777671 15:23596881-23596903 CATTACTCAGAGAGAATCAGTGG + Intronic
1124145542 15:27122088-27122110 AATAACTAAAAGAGTGTAATTGG + Intronic
1124508304 15:30298159-30298181 AATAACTAAAATAGTATAATTGG + Intergenic
1124735252 15:32240497-32240519 AATAACTAAAATAGTATAATTGG - Intergenic
1124895199 15:33769959-33769981 TATAAATAAGAGAGAAGCAGTGG + Intronic
1125138749 15:36377452-36377474 AATAACTAAAAGAGTAGAACTGG - Intergenic
1125211335 15:37218902-37218924 AATAGCTAAAAGAGAATAAGTGG + Intergenic
1125249850 15:37688307-37688329 AATAACTGAAAGAGTATAATTGG + Intergenic
1125877132 15:43159246-43159268 AATAACTAAAAGAGTGTAATTGG - Intronic
1126052423 15:44698254-44698276 AATAACTAAAATAGTATAATTGG - Intronic
1126195888 15:45931072-45931094 AATAACTAAAAGAGTGTAATTGG + Intergenic
1126250219 15:46558746-46558768 AATAACTAAAAGAGTATAATTGG - Intergenic
1126293970 15:47116507-47116529 AATAACTAAAAGAATATAATTGG - Intergenic
1126486058 15:49182001-49182023 AATAACTAAAAGATTATCATTGG - Intronic
1126521611 15:49601644-49601666 AATAACTAAAAGAGTATAATTGG - Intronic
1126522615 15:49613607-49613629 AATAAATAAAAGAGTATAATTGG + Intronic
1126904870 15:53353799-53353821 AATAACTAAAATAGTATAACTGG - Intergenic
1126940485 15:53760177-53760199 AATAACTAAAAGAGTATAATTGG - Intronic
1126944097 15:53799111-53799133 AATAACTTAAAGAGTATAATTGG - Intergenic
1126944150 15:53799794-53799816 AATAACTTAAAGAGTATAATTGG + Intergenic
1126958614 15:53963816-53963838 AATGACTAAGAAATTATCAGGGG + Intergenic
1126965914 15:54053643-54053665 AATAAGTAAAAGAGTATAATTGG - Intronic
1126975366 15:54172236-54172258 AATAATTAAAAGAGTATAATTGG + Intronic
1127018808 15:54721862-54721884 AGTAACTAAAAGAGTATAATTGG - Intergenic
1127033082 15:54885594-54885616 AATAACTAAAAGAGTATAAGTGG - Intergenic
1127155306 15:56118193-56118215 AATAACCAAAAGAGTATAAATGG - Intronic
1127243303 15:57142993-57143015 AATAACTAAAAGAGTATATTTGG + Intronic
1127467650 15:59259834-59259856 AATGACTTTGAGAGTCTCAGGGG - Intronic
1127476763 15:59341218-59341240 AATAACTAAAAGAGTATTACTGG - Intronic
1127493881 15:59491554-59491576 CATAACTAAAAGAGTATAATTGG + Intronic
1127545899 15:59994218-59994240 AATAAATAAGAAAGTGTCACTGG - Intergenic
1127837509 15:62801962-62801984 AATAACTAAAAGAGTATAATTGG - Intronic
1127878819 15:63137628-63137650 AATAACTAAAAGAGTAGGATTGG - Intronic
1128589341 15:68880968-68880990 AATAACTAAAAGAGTGTAATTGG + Intronic
1128623117 15:69168992-69169014 AATGACTAAGAGAGTACAGGAGG - Intronic
1128935644 15:71744330-71744352 AGTACCTAGGAGAGTAGCAGGGG - Intronic
1129091347 15:73154355-73154377 AATAATTAAGAGAGAATAACTGG - Intronic
1129122134 15:73405366-73405388 AATAACTGAAAGAGTATGATTGG - Intergenic
1129545928 15:76394849-76394871 AATAACTAAAAGAATATAATTGG - Intronic
1130038484 15:80383137-80383159 AATAACTAAACGAGTATAATTGG + Intronic
1130173251 15:81539364-81539386 AATAGCTAAAAGAGTATAACTGG + Intergenic
1130962517 15:88672176-88672198 AATAAGTAAAAGAGTATAACTGG + Intergenic
1131314648 15:91323792-91323814 AATAACTAAAATAGTATAATTGG - Intergenic
1131395325 15:92081101-92081123 AATAACTGAAAGAGTATCACTGG - Intronic
1131989052 15:98075382-98075404 AATAGATAAGTGATTATCAGAGG + Intergenic
1131998563 15:98157237-98157259 AATATCTAAGAAAGAATGAGAGG + Intergenic
1132127769 15:99243959-99243981 AATAACTAAAAGAGTAGAATTGG + Intronic
1132444431 15:101899662-101899684 AATAACTGAAAGAGTATAACTGG - Intergenic
1133176802 16:4021558-4021580 CAGAGCTAGGAGAGTATCAGAGG + Intronic
1133449677 16:5893401-5893423 AATAACTAAAAGAGTCTAACTGG + Intergenic
1133457756 16:5957820-5957842 AATAACTAAAAGAGTATAAGTGG - Intergenic
1133490015 16:6258744-6258766 AATAACTAAGAGAGTTTAGTTGG + Intronic
1133515997 16:6509671-6509693 AATAAGTAAAAGAGTATAATCGG + Intronic
1133699264 16:8293987-8294009 CATAACTAAAAGAGTATAACTGG + Intergenic
1133833542 16:9346408-9346430 AATAACTAAAAGAGTATAATTGG - Intergenic
1133988621 16:10687985-10688007 AATAACTTAAAGAGTATAAATGG - Intronic
1134293182 16:12920483-12920505 AATAACTTAAAGAGTGTCATTGG + Intronic
1134375338 16:13666968-13666990 AATAACTGAAAGAGTATAATTGG - Intergenic
1134615471 16:15648220-15648242 AATAACTAAAGGAGTATAATTGG - Intronic
1134785500 16:16938707-16938729 AATAACTAAAAGAGTATAATTGG - Intergenic
1134787601 16:16959372-16959394 AATAACTAAAAGAGTATAACTGG - Intergenic
1134793897 16:17016729-17016751 AATAACTAAAAGAGTATAACTGG - Intergenic
1134915539 16:18067712-18067734 AATAACTTAAAGAGTATAATTGG + Intergenic
1135354902 16:21760893-21760915 AATAACTAAAAGAGTACAATTGG - Intergenic
1135499159 16:22978782-22978804 AATAACTAAAAGAGTATAATTGG - Intergenic
1135500018 16:22987635-22987657 AATAACTAAAAGAATATAATTGG - Intergenic
1135772269 16:25226664-25226686 AATAACAAAAAGTGTATCATAGG - Intronic
1135879966 16:26245684-26245706 AATAACTAAAAGAGTATAATTGG + Intergenic
1135977223 16:27116566-27116588 AATAACTAAAAGAGTGTAATTGG - Intergenic
1137358268 16:47787701-47787723 AATAACTAAAATAGTATAATTGG - Intergenic
1137578004 16:49616460-49616482 AATAACTAAAAGAGTATAATTGG + Intronic
1137691055 16:50428073-50428095 AATAACTAAAATAGTATAATAGG - Intergenic
1137974036 16:53015314-53015336 AATAACTAAAAGCGTATAATTGG - Intergenic
1138218787 16:55231406-55231428 AATAACTAAAAGAGTATAACTGG - Intergenic
1138362750 16:56445430-56445452 AATAACTAAAAGAGTATAATTGG - Intronic
1138916967 16:61476410-61476432 AATAACTAAAAGAGTGTAATTGG + Intergenic
1139070586 16:63376623-63376645 AATAACTAAAAGAGTAGAATTGG + Intergenic
1139085747 16:63583641-63583663 AATAACTAAAAGAGTATAACTGG + Intergenic
1139123329 16:64046764-64046786 AATAACTAAAAGAATATAAATGG + Intergenic
1139273398 16:65704397-65704419 AATACCTAAAAGAGTATAATTGG + Intergenic
1140343083 16:74184612-74184634 AATAACTAAAAGAGTACAATTGG + Intergenic
1140544654 16:75795487-75795509 AATAACTAAAAAAGTATAATTGG - Intergenic
1140545412 16:75803669-75803691 AATAACTAAAAGAGTATAATTGG - Intergenic
1140550880 16:75864184-75864206 AATAACTAAAAGAGCATAATTGG - Intergenic
1140584284 16:76270424-76270446 AATAACTAAAATAGTATAATTGG + Intergenic
1140742757 16:77956061-77956083 AATAACTAAAAGAGTATAATTGG + Intronic
1141038489 16:80651091-80651113 AATAACTAAAAGAGTGTAACTGG + Intronic
1141094805 16:81155566-81155588 AATAATTAAAAGAGTATAATCGG + Intergenic
1141122227 16:81368722-81368744 AATAACTGTGAGGGTAGCAGCGG - Intronic
1141221940 16:82079011-82079033 AATAACTAAAAGAGCATAAATGG + Intronic
1141226910 16:82126185-82126207 AATAACTAAAAGAGTATATTCGG + Intergenic
1141263508 16:82475088-82475110 AAGAACGAAGAGAGTCTCAGAGG - Intergenic
1141494676 16:84399769-84399791 AATAACTCAAAGAGTGTAAGTGG - Intronic
1142909547 17:3076340-3076362 AATAACTAAAAGAGTATAACTGG - Intergenic
1142924953 17:3227474-3227496 AATAACTAAAAGGGTATAATTGG + Intergenic
1142927738 17:3255894-3255916 AATAACTAAAAGAGTATAATTGG + Intergenic
1143420364 17:6786485-6786507 AAAAACTAAAAGAGTATAATTGG + Intronic
1143430044 17:6875044-6875066 AATAACTAAAAGAGTATAATTGG - Intergenic
1146242161 17:31240090-31240112 AATCACTAAAAGAGTATAATTGG - Intronic
1147025119 17:37575286-37575308 AATAACTTACAGAGTATAATTGG + Intronic
1147053536 17:37816396-37816418 AATAACTAGAAGGGAATCAGAGG - Intergenic
1148172638 17:45535859-45535881 AAGCACTAAGAGAGAATAAGAGG - Intergenic
1148276632 17:46309590-46309612 AAGCACTAAGAGAGAATAAGAGG + Intronic
1148298749 17:46527178-46527200 AAGCACTAAGAGAGAATAAGAGG + Intronic
1148359799 17:47002356-47002378 AATAATTAAGAGTGTATAATTGG - Intronic
1148363283 17:47031675-47031697 AAGCACTAAGAGAGAATAAGAGG + Intronic
1149110832 17:53027822-53027844 AATAACTAAAAGAGTATAATTGG - Intergenic
1149184225 17:53978352-53978374 AATAACTAAAAGAGTATAATTGG - Intergenic
1149240979 17:54648718-54648740 CATAACTAAAAGAGTATAATTGG + Intergenic
1149657246 17:58316687-58316709 ACTAATTTAGAGAGCATCAGGGG - Intronic
1149676633 17:58470479-58470501 AATAAATTAGAGATTACCAGGGG + Intronic
1149738687 17:59021752-59021774 AATAACTAAAAGAGTACAATTGG + Intronic
1150035758 17:61795244-61795266 AATAACTAAAAGAATATAATTGG - Intronic
1150201291 17:63360640-63360662 AATAACTAAAAGAGTATAATTGG - Intronic
1150419549 17:65019810-65019832 AATAACCAAAAGAGTATAATTGG + Intronic
1150463114 17:65369520-65369542 AATAACCAAAAGAGTATAATGGG - Intergenic
1150636086 17:66914275-66914297 AGAAAATAAGAGAGTTTCAGGGG - Intergenic
1150879893 17:69012739-69012761 AATAACTAAAAGAGTATAATTGG - Intronic
1150945813 17:69744291-69744313 AATAACTAAAAGAGTATAATTGG + Intergenic
1151053668 17:71007515-71007537 AATAACTAAGCAAGTATAATTGG + Intergenic
1151141524 17:71997157-71997179 AATAATGAAAAGAGTATCAATGG + Intergenic
1151167034 17:72212946-72212968 AATAATTAAAAGAGTATAATTGG - Intergenic
1151273137 17:73012287-73012309 AATAACTAAAAGAATATAATTGG + Intronic
1151762616 17:76114564-76114586 AATAACTGAAAGAGTATAATTGG + Intronic
1152007156 17:77689757-77689779 AATAACTTAAAGAGTGTCATTGG + Intergenic
1152039834 17:77895667-77895689 AATAACTTAAAGAGTGTCATTGG - Intergenic
1153055138 18:938415-938437 AATAACTGAAAGAGTATAATAGG - Intergenic
1153074794 18:1149549-1149571 AATAACTAAAAGAGTATAATTGG - Intergenic
1153089424 18:1326825-1326847 AATAACTAAAAGAGTATAACTGG + Intergenic
1153183017 18:2457154-2457176 AATAACTAAAAGGGTATAATTGG - Intergenic
1153426246 18:4967781-4967803 AATTACTAAAAGAGTATCCTTGG + Intergenic
1153430603 18:5012333-5012355 AATAACTAAAGGAGTATAACTGG + Intergenic
1153714376 18:7831620-7831642 GATAACTAAAAGAGTATAATTGG - Intronic
1153854124 18:9128279-9128301 AATTACTAAGAGGGTATGAGTGG + Intronic
1153856659 18:9155267-9155289 AGTAACTAAAAGAGTATAATTGG + Intronic
1153997099 18:10452639-10452661 AATGGCTAAGAGAGTGTTAGGGG - Intergenic
1154284864 18:13044008-13044030 AATAACTAAGAGTATATAATTGG - Intronic
1155091908 18:22520333-22520355 AATAACTTAAAGAGTATAATTGG + Intergenic
1155110465 18:22709302-22709324 AAGAACAAGGAGAGTAGCAGGGG - Intergenic
1155317184 18:24583679-24583701 AATAACTAAAAGAGTATAATTGG - Intergenic
1155387522 18:25295452-25295474 AATAACTAAAAGGGTATAACTGG + Intronic
1155443942 18:25891123-25891145 AACAACTAAAAGAGTATAACTGG + Intergenic
1155470798 18:26190274-26190296 GATAACTAAAAGAGTATAATTGG + Intronic
1155509067 18:26559237-26559259 AATAACTAAAAGAGTATAATTGG + Intronic
1155534414 18:26802154-26802176 AATAACTAAAAGAGTGTGATTGG + Intergenic
1155601466 18:27553552-27553574 AATAAATAAAAGAGTACCTGTGG - Intergenic
1155688741 18:28589849-28589871 AATAACTAAAAGAGTGTTATTGG - Intergenic
1155763874 18:29603093-29603115 AATAACTAAAAGAGTGTAACTGG + Intergenic
1155884714 18:31193627-31193649 ACTACCTAAGAGAGCATGAGGGG + Intergenic
1156056116 18:33005593-33005615 AATAACTAATAGAGAATAATTGG + Intronic
1156133634 18:34008464-34008486 ATTAACTAAGATATTATCACTGG - Intronic
1156371880 18:36478419-36478441 AATAACTAGAAGAGTATGATTGG - Intronic
1156911802 18:42419779-42419801 AATAACTAAAAGAGTATAATTGG - Intergenic
1156911877 18:42420699-42420721 AATAACTAAAAGAGTATAATCGG - Intergenic
1156976913 18:43233719-43233741 AATAACTAAAAGAGTATACTTGG - Intergenic
1157636329 18:49158888-49158910 AATAACTAAAAGAGCATAATTGG + Intronic
1157786839 18:50491337-50491359 AAAAAGTCAGAGAATATCAGAGG + Intergenic
1157886950 18:51377717-51377739 AAGAACTAAAAGAGTATAATTGG + Intergenic
1158090144 18:53701369-53701391 AATAACTAAATGAGTATAACTGG - Intergenic
1158118319 18:54021710-54021732 AATAACTAAGAGGGTATAATTGG + Intergenic
1158267280 18:55673861-55673883 AATAACTAAAAGAGTAGTAGCGG - Intergenic
1158269890 18:55701293-55701315 AATAACTAAAAGAGTGTAATAGG - Intergenic
1158706784 18:59799641-59799663 AATGACTAAGACAGTATCAAGGG + Intergenic
1158879851 18:61767326-61767348 AATAACTAAAAGAGTATAATTGG - Intergenic
1159056386 18:63468937-63468959 AATGACTAAAAGAGTATAATTGG + Intergenic
1159091436 18:63853519-63853541 AATAACTAAAAGAGTATATTTGG - Intergenic
1159284640 18:66333955-66333977 AATAACTGAAAGAGTATAATGGG - Intergenic
1159339126 18:67112112-67112134 AATAACCAAAAGAGTATAATTGG - Intergenic
1159423779 18:68257649-68257671 AATAACTAAAAGAGTGTAATGGG - Intergenic
1159478466 18:68955918-68955940 AATAACTAAAAGAGTGTAATTGG - Intronic
1159825989 18:73210990-73211012 AATAAATAAGGGAGTTTAAGGGG - Intronic
1159848049 18:73489898-73489920 AATAACTAAAAGAGTACAACTGG - Intergenic
1160471569 18:79139684-79139706 AACAACTAAAAGAGTGTAAGTGG - Intronic
1160640923 19:135153-135175 AATAACTGAAAGAGTATAATTGG + Intergenic
1161926284 19:7302662-7302684 AATAACTAAAAGAGTATAACTGG + Intergenic
1162614873 19:11791125-11791147 AATAACTAAAAGAGTATAATTGG + Intergenic
1162698309 19:12494755-12494777 AATAACTAAAAGAGTATAATCGG + Intronic
1162865633 19:13544221-13544243 AATAACTAAAAGAGCATAATTGG + Intronic
1164420124 19:28083497-28083519 AATAACTAAAAGAGTGTAATTGG - Intergenic
1164443162 19:28294848-28294870 AATAACTAAAAGAGTATAATTGG - Intergenic
1164456779 19:28414366-28414388 AATAACTCAAAGAGTATAATTGG - Intergenic
1164466583 19:28492091-28492113 AATAACTAAGAGAGCACAACGGG + Intergenic
1164855953 19:31521674-31521696 AATAACTAAAAGAGTATAAGTGG - Intergenic
1164892445 19:31836408-31836430 AATAACTAAAAGAGTATAATTGG + Intergenic
1164923420 19:32107108-32107130 AATAACTAAAAGCGTATAATTGG - Intergenic
1165566989 19:36738990-36739012 AATACCTAAAAGAGTATAATTGG + Intronic
1165678693 19:37753373-37753395 AATAACTAAAAGAATATAATTGG - Intronic
1166039790 19:40194883-40194905 AAAATTTCAGAGAGTATCAGGGG + Intronic
1166087054 19:40483339-40483361 AATAATTAAAAGAGTATAATTGG + Intronic
1166778236 19:45325258-45325280 AATAACTAAAGGAGTATAATTGG + Intergenic
1166971414 19:46570962-46570984 AATAACTAAAAGAGTATATTTGG + Intronic
1167805086 19:51777056-51777078 AAAAACTAAAAGAGTATAACTGG + Intronic
1168383076 19:55940667-55940689 AATAACTAAAATAGTATAATTGG - Intergenic
1168617286 19:57848863-57848885 AATAACTAAAAGAGTATAACTGG - Intronic
1168621855 19:57885784-57885806 AATAACAAAAAGAGTATAATTGG + Intronic
925228613 2:2209254-2209276 AATAGCTAAAAGAGTATGATTGG - Intronic
925384961 2:3455372-3455394 AATAACTAAGGGAGCATAATTGG - Intronic
925608331 2:5682162-5682184 AATAACTAAAAGAGTGGCACTGG + Intergenic
925776230 2:7338538-7338560 AATAACTAAGAGATTATAATTGG - Intergenic
926065408 2:9835587-9835609 AATAACTAAGAGAGTGTAATTGG + Intergenic
926473488 2:13292010-13292032 AATAACTAAAAGAATATAATTGG - Intergenic
926487672 2:13482652-13482674 AATAACTAAAAGAGCATAATTGG + Intergenic
926617903 2:15016991-15017013 AATAACTAAAAGTGTATAACTGG - Intergenic
926658408 2:15436104-15436126 TAGAATTAAGAGAGTATCAATGG - Intronic
927437548 2:23082117-23082139 AATAACGAAAAGAGTATAATTGG - Intergenic
927594413 2:24384229-24384251 AAAAACTAAAAGAGTATAATTGG - Intergenic
927839203 2:26427579-26427601 AATAACTAAAAGAGTATAACTGG - Intronic
928009064 2:27591366-27591388 AATAACTAAAAGAGTGTAATTGG - Intronic
928026198 2:27741315-27741337 AACAACAAAGAAATTATCAGGGG - Intergenic
928459936 2:31462491-31462513 AATAACTAAAAGAGTATAAATGG + Intergenic
928474044 2:31606278-31606300 AATAACTAAAAGAGCATAATTGG + Intergenic
928475615 2:31624234-31624256 AGTAACTAAAAGAGTATAATTGG - Intergenic
928725196 2:34164368-34164390 AATAACTAAAAGAGTGTGATTGG - Intergenic
928821278 2:35365332-35365354 TATCTCTAAGAGAGCATCAGAGG - Intergenic
928825000 2:35409788-35409810 AATTACTAAGAGAAAGTCAGAGG + Intergenic
928847309 2:35692622-35692644 AATAACTAAAAGAGTATAATTGG - Intergenic
929016032 2:37496084-37496106 AATAACTAAAAGAGTATATTTGG - Intergenic
929059484 2:37908714-37908736 AATAACTAAAAGAATATAATTGG + Intergenic
929324319 2:40589054-40589076 AATAACTAAAAGAGTACAATTGG + Intronic
929519092 2:42631657-42631679 AATAACTAAAAGAGTATAACTGG - Intronic
930169828 2:48239956-48239978 AATAACTAAAAGAATATAATTGG + Intergenic
930215825 2:48696091-48696113 AAGAAATAAGAGACAATCAGGGG - Intronic
930297325 2:49571118-49571140 AATAACTAAAAGAGTATGAATGG - Intergenic
930376143 2:50569275-50569297 AATAACTAAAAGAGTGTAATTGG + Intronic
930475871 2:51881361-51881383 AATAACTAAAAGACTATGAATGG + Intergenic
930522253 2:52482212-52482234 AATAACTAAAAGAGTATAATTGG + Intergenic
930579943 2:53198558-53198580 AATAACTAAAAGAGTGTAATTGG + Intergenic
930588347 2:53297084-53297106 AATAACTAAAAGAGTGTAATTGG + Intergenic
930810596 2:55536438-55536460 AATAAATAAAAGAGTATAAAAGG - Intronic
930916943 2:56703683-56703705 AATAACTACAAAAGTCTCAGTGG - Intergenic
930944378 2:57055033-57055055 AATAACTAAAAGAATATAACTGG - Intergenic
930985657 2:57584643-57584665 AGTAACTAAAAGAGTATAATTGG - Intergenic
931090996 2:58885895-58885917 AATGACTGATAGAGTGTCAGGGG + Intergenic
931146893 2:59528985-59529007 AATATATAAGAAATTATCAGTGG - Intergenic
931484606 2:62677499-62677521 AATAACTAGAAGAGTATAATTGG - Intronic
931529812 2:63200794-63200816 AATAACTAAAGGAGTATAATTGG + Intronic
931530003 2:63203316-63203338 AATGACTAAAAGAGTATAATTGG - Intronic
931530019 2:63203511-63203533 AATAACTAAAAGAGCATAATTGG - Intronic
931568366 2:63640820-63640842 AATAACTAAAAAAGTATAATTGG - Intronic
931572904 2:63688613-63688635 AATAACTAAAAGAGTGTAATTGG + Intronic
932015397 2:68021739-68021761 AATAACTAAAATAGTATAATTGG - Intergenic
932187130 2:69707736-69707758 AATAACTAAAAGAGTATAATTGG - Intronic
932272982 2:70427074-70427096 AATAACTAAAAGACTATAATTGG + Intergenic
932287147 2:70545000-70545022 AATAGCTAAAAGAGTATAATTGG + Intronic
932890036 2:75586498-75586520 AATAACTAAAAGAGTATAATTGG + Intergenic
933078480 2:77958568-77958590 AATAACTGAAAGAGCATCATTGG + Intergenic
933098358 2:78217285-78217307 AATAACTAAAAGTGTATAATTGG + Intergenic
933210096 2:79556532-79556554 TGTAACTAAGAATGTATCAGGGG - Intronic
933229572 2:79790752-79790774 AATAACTATGATTGGATCAGGGG - Intronic
933239211 2:79900783-79900805 AATAACTAAAAGAGTATAATGGG + Intronic
933452910 2:82479533-82479555 AATAACTATAAGAGTATAACTGG + Intergenic
933543787 2:83683021-83683043 AATAACTAAAAGAGTATACATGG + Intergenic
933627406 2:84617356-84617378 AATAACTAAAAGAGTATAACTGG - Intronic
933871598 2:86571275-86571297 AACAACTAAGAGAGTATAATTGG + Intronic
933949584 2:87316831-87316853 AATACCTAAAAGAGTATAATTGG - Intergenic
934125685 2:88887035-88887057 AATAACTAAAAGAGTGTAATTGG - Intergenic
934521556 2:95023203-95023225 AATAACTCAGTGAGTATCCTTGG - Intergenic
934612243 2:95749147-95749169 AATAACTAAAAGAGTGTAATTGG + Intergenic
934841909 2:97630309-97630331 AATAACTAAAAGAGTGTAATTGG - Intergenic
935309949 2:101773597-101773619 AATAACTAAAACAGTATAACTGG - Intronic
935496735 2:103791719-103791741 AATAACTAAAAGAGTATAATTGG + Intergenic
936121804 2:109752727-109752749 AATAACTAAAAAAGTATAATTGG - Intergenic
936222891 2:110618745-110618767 AATAACTAAAAAAGTATAATTGG + Intergenic
936256155 2:110915004-110915026 AATAACTAAAAGAGTGTCATTGG - Intronic
936330607 2:111544766-111544788 AATACCTAAAAGAGTATAATTGG + Intergenic
936510788 2:113144112-113144134 AATAACTAAAAGAGTATAATTGG - Intergenic
936549084 2:113419488-113419510 AATAACTAAAAGAGTATAATTGG + Intergenic
936783834 2:116068193-116068215 AATTACTAAAAGAGTATAATTGG - Intergenic
937116590 2:119409417-119409439 AATAAGTAAAAGAGTATAATTGG - Intergenic
937391710 2:121494580-121494602 AATAACTGAAAGAGTATAACTGG + Intronic
937580490 2:123481095-123481117 AAAAAGTTAGAGAGTAGCAGGGG - Intergenic
937612963 2:123885533-123885555 AATAACTGAAAGAGTATAATTGG - Intergenic
937628734 2:124074327-124074349 AATAACTAAAAGAATATAATTGG + Intronic
937673649 2:124565323-124565345 AGTAACTAGAAGAGTATCATTGG + Intronic
937736244 2:125294236-125294258 AATAACTAAAAGAGTATAATTGG - Intergenic
937802732 2:126099312-126099334 AATAACTAAAAAAGTATAATTGG + Intergenic
938077766 2:128349237-128349259 AATAACTAAAAGAGTGTAATTGG - Intergenic
938253783 2:129837142-129837164 AATAACTAAAAGAGTATAATTGG + Intergenic
938607448 2:132910259-132910281 GATAACTAAAAGAGTATAATTGG - Intronic
939086436 2:137724350-137724372 AATAACTAAAAGAGTATAATTGG + Intergenic
939133463 2:138265941-138265963 AATAACTAAAAGAGTGTAATTGG + Intergenic
939241657 2:139568776-139568798 AATAACTAGAAGAGTATAATTGG + Intergenic
939331865 2:140773481-140773503 AATAAATAAGAGAATGTGAGGGG + Intronic
939404620 2:141740592-141740614 AATAACTGAAAGAGTATAATTGG - Intronic
939484024 2:142786565-142786587 AATAACTAAGACACTATAATAGG + Intergenic
939649546 2:144744247-144744269 AATAAGTAAAAGAGTATAATTGG - Intergenic
939683951 2:145174475-145174497 AATAACTAAAAGAGTATAACTGG - Intergenic
939701287 2:145395168-145395190 AATAACTAAAAGTGTATAATTGG + Intergenic
939710161 2:145507550-145507572 AATAACTAAAACAGTATAATTGG - Intergenic
939752133 2:146061266-146061288 AATAACTAAGAGAGTACAAATGG + Intergenic
940021861 2:149164435-149164457 CATCACTAAGGGAGAATCAGGGG - Intronic
940412788 2:153385694-153385716 AATAACTAAAAGAGCATTACTGG + Intergenic
940557861 2:155255190-155255212 AATAACAAAAAGAGTATAATTGG - Intergenic
940560556 2:155290390-155290412 AATAACTAAAAGAGTATAATTGG + Intergenic
940793295 2:158050905-158050927 AATAACTAAAAGAGTATAATTGG + Intronic
940922273 2:159321882-159321904 AATAAGTAAAAGAGTAGAAGTGG + Intronic
940990956 2:160095925-160095947 AATAACTAAAAGAGTATAATTGG + Intergenic
941000744 2:160201273-160201295 AATAACTAAAAGACTATAAATGG + Intronic
941134079 2:161691450-161691472 AATAACTAGAAGAGTATAACTGG + Intronic
941169713 2:162121581-162121603 AATAAGTAGGAGAGAATTAGAGG + Intergenic
941201876 2:162521758-162521780 AATAACTAAAAGAGTAGAATTGG - Intronic
941299408 2:163782986-163783008 AATAACTAAAAGAATATAATTGG - Intergenic
941341324 2:164308781-164308803 AATAACTAAAAGAATATAATTGG + Intergenic
941488284 2:166110004-166110026 AATAGCTAAAAGAGTATAATTGG + Intronic
941679169 2:168378152-168378174 AATAACTAAAAGATTATAATTGG + Intergenic
941697784 2:168571821-168571843 AATAATTAAAAGAGTATAATTGG - Intronic
941745628 2:169083846-169083868 AATAACTCAAAGAGTATAATTGG - Intronic
941807827 2:169726681-169726703 AATAACTAAAAGAGTATAATTGG + Intronic
942130031 2:172869286-172869308 AATAACTAAGAATTTATCAAGGG - Intronic
942192351 2:173482716-173482738 AATAGCTAAAAGAGTATAATTGG - Intergenic
942524151 2:176835326-176835348 AATAACTAAAACAGTATAATTGG + Intergenic
942529652 2:176895785-176895807 AATAACTAAGAACGTATAATTGG - Intergenic
942663728 2:178293640-178293662 AATAACTGAAAGAGTATAATTGG - Intronic
942679251 2:178459546-178459568 AATAACTAAAAGAGTATAATTGG - Intronic
942773042 2:179545903-179545925 AATAACTAAAAGAGTATAATTGG - Intronic
942843333 2:180391485-180391507 AATAACTAAAAGAGTGTAATTGG - Intergenic
943090970 2:183374645-183374667 AATAACTAAAAGAGTATAATTGG + Intergenic
943128560 2:183827488-183827510 AATAACTAAAAGAGTGTAATTGG + Intergenic
943170487 2:184391440-184391462 AATAACTAAAACAGTATAACTGG + Intergenic
943311040 2:186324988-186325010 AATAACTTAAAGAGTATAATTGG + Intergenic
943372888 2:187037667-187037689 GATAACTGAGAGATTATCATAGG + Intergenic
943582416 2:189700549-189700571 CATAACTAAAAGAGTATAACTGG - Intronic
943602490 2:189938698-189938720 AATAACTAAAAGAGTATAATTGG + Intronic
944100303 2:196018803-196018825 AATAACTAAAGGAGTATAACTGG + Intronic
944187463 2:196965206-196965228 AATAACTAAAAGAGTATAATTGG + Intergenic
944216098 2:197257569-197257591 TATAACTAAAAGAGTATAATTGG + Intronic
944300601 2:198120326-198120348 AATAACTAAAAGAGTATAATTGG - Intronic
944478634 2:200132161-200132183 AATAACTAAAAGAGTGGAAGTGG + Intergenic
944724238 2:202453803-202453825 AATAACTAATAGAGTATAATTGG + Intronic
944724965 2:202461791-202461813 AATAACTAAGAAAATGTCAAAGG - Intronic
944773526 2:202938104-202938126 AATAATTAAAAGAGTATAATTGG - Intronic
944842774 2:203640319-203640341 AATAACTTAAAGAGTATAATTGG - Intergenic
944955859 2:204807944-204807966 AATAACTAAAAGAGTATAACTGG + Intronic
945010095 2:205451823-205451845 AATACCTAAAAGAGTATAATTGG - Intronic
945378484 2:209109575-209109597 AATAACTAAAAGAGTATAACTGG + Intergenic
945519682 2:210809822-210809844 AATAACTAAAAGAGTATAATTGG - Intergenic
945930146 2:215846670-215846692 AATAGATCAGAGAATATCAGTGG + Intergenic
946088877 2:217202433-217202455 AATAACTAAAAGACTATAACTGG + Intergenic
946357163 2:219195035-219195057 AATAACTAAAAGAGTATAATTGG - Intergenic
946508545 2:220328369-220328391 AATAACTAAGAGGTTATAATTGG - Intergenic
946535979 2:220628856-220628878 AATAACTAAAAGAGTATAATTGG + Intergenic
946676747 2:222168502-222168524 AATAACTAAAAGAGTATGATAGG - Intergenic
946697949 2:222380279-222380301 AATAACTCAAAGAGTATAACTGG + Intergenic
946952954 2:224897410-224897432 AATAACTAAAAGAGTATAATTGG - Intronic
947036519 2:225864622-225864644 AATAACTAAAAGTGTATAACTGG + Intergenic
947127861 2:226890670-226890692 AATAACTAAAAGAGCATAATTGG - Intronic
947130472 2:226918330-226918352 AATAACTAAAAGAGTAGAACTGG - Intronic
947438958 2:230100509-230100531 AATAACTAAAAGAGTATACTTGG - Intergenic
947538247 2:230954620-230954642 AATAACTAAAAGAGTATAACTGG - Intronic
947538620 2:230958396-230958418 AATAACTAAAAGAGTATAATTGG - Intronic
947584996 2:231349863-231349885 AATAACTAAAAGAGTATGATTGG + Intronic
1168772739 20:426220-426242 AATAACTAAGAGAGGTTAACTGG - Intronic
1168796426 20:612695-612717 ACAAACTATGAGACTATCAGGGG - Intergenic
1168899310 20:1347976-1347998 AATAACTAAAAGAGTATAATTGG - Intronic
1169392982 20:5205078-5205100 AATAACTGACAGATTACCAGAGG - Intergenic
1169397202 20:5242536-5242558 AATAACTAAAACAGTATAATTGG + Intergenic
1169647086 20:7823841-7823863 AATAACTAAAAGAGCATAACTGG + Intergenic
1169651670 20:7875052-7875074 AATAACTAAAAGAGGGTCATTGG + Intergenic
1169991668 20:11511030-11511052 AATAACTAAAAGAGTGTAACTGG + Intergenic
1170176872 20:13480958-13480980 AATAACTAAAAGAGTGTAATTGG - Intronic
1170335001 20:15260142-15260164 AATAACTAAAAGAGTGCCATTGG - Intronic
1170490620 20:16869994-16870016 AATAACTAAAAGAGTATAATTGG + Intergenic
1170511155 20:17078182-17078204 AGTAACTAAAAGAGTATAATTGG - Intergenic
1170708789 20:18769937-18769959 AATAACTAAAAGAGTATAATTGG - Intergenic
1170976547 20:21170298-21170320 AATAACCAAAAGAGTATAACTGG - Intronic
1171024952 20:21621789-21621811 AATAACTAAAAGATTATAACTGG + Intergenic
1171776895 20:29377053-29377075 AAAAACTAAAAGAGTATAATTGG - Intergenic
1171818276 20:29808490-29808512 AAAAACTAAAAGAGTATAATTGG - Intergenic
1171899525 20:30844489-30844511 AAAAACTAAAAGAGTATAATTGG + Intergenic
1171946649 20:31384270-31384292 AATAACTAAAAGAGTATAATTGG + Intronic
1172203257 20:33141820-33141842 AATAACTAAAAGAGCATAATTGG - Intergenic
1172738624 20:37148346-37148368 AATAACTAAAAGAATATAATTGG - Intronic
1172761324 20:37325146-37325168 AATAACTAAAAGAATATAACTGG - Intergenic
1173303339 20:41824450-41824472 AATAACTAAAAGAATATAATTGG - Intergenic
1173361980 20:42352703-42352725 AATAACTAAAAGGGTATAATTGG + Intronic
1173390805 20:42630891-42630913 AATCACTCAGAGAATATCTGTGG - Intronic
1173435253 20:43026600-43026622 AATAACTAAGAGAATATAATTGG - Intronic
1173557908 20:43980489-43980511 AATAACTGAAAGAGTATAATTGG + Intronic
1173602577 20:44306611-44306633 AAGAAATAAAAGAGTAACAGAGG - Exonic
1174283135 20:49453684-49453706 AATAACTAAAAGAGTGTAATTGG - Intronic
1174838785 20:53882216-53882238 AATAACTAAAAAAGTATAACTGG - Intergenic
1175680163 20:60981381-60981403 AATAACTAAAATAGTATAATTGG + Intergenic
1176524412 21:7855014-7855036 AATAACTAAAAGAGTATACTTGG + Intergenic
1176939288 21:14904356-14904378 AATAACGAAAAGAGTATAATTGG - Intergenic
1177128561 21:17228175-17228197 AATAACTAAAAGAGTATAATTGG + Intergenic
1177231651 21:18328757-18328779 AATAACTAAAAGAATATAATTGG + Intronic
1177330366 21:19652332-19652354 AATAACTAAAAGAGTAGAATTGG + Intergenic
1178382921 21:32126359-32126381 AATAACTAAAAGAGTATAATTGG - Intergenic
1178459100 21:32785071-32785093 AATAACTAAAAGAGTGTAATTGG - Intergenic
1178658432 21:34485027-34485049 AATAACTAAAAGAGTATACTTGG + Intergenic
1178808176 21:35856868-35856890 AATAACTAAAAGAGTATAATTGG + Intronic
1178927274 21:36786510-36786532 AATGAGTAAGGGAATATCAGAGG + Intronic
1178934752 21:36851659-36851681 AATAACTAAAAGAATATAATTGG + Intronic
1179653055 21:42827114-42827136 AATAACTAAAAGAGTATAATTGG - Intergenic
1180333338 22:11552769-11552791 AAAAACTAAAAGAGTATAATTGG + Intergenic
1181444115 22:22955824-22955846 AACAACTAACAGAGTAGCAAGGG + Intergenic
1181717956 22:24748411-24748433 AATAACTAAAAGAATATAATTGG + Intronic
1181740279 22:24915703-24915725 AATAACTAAAAGTGTATAATTGG - Intronic
1182100383 22:27653710-27653732 AATAACTAAAAGAGTATAATTGG + Intergenic
1182177881 22:28311666-28311688 AATAACTAAAAGAGTATAATTGG - Intronic
1182730083 22:32481935-32481957 AATAGCTCAGAGAATGTCAGTGG + Intronic
1182851929 22:33482732-33482754 AATAACTGAAAGAGTATTATTGG - Intronic
1183318681 22:37150586-37150608 AATAACTAAAAGAGTATACTTGG - Intronic
1183874917 22:40771840-40771862 AATAACTAAAAGAGTATAATAGG + Intronic
1184305543 22:43598629-43598651 AATATCTAAAAGAGTATAATTGG + Intronic
1184703399 22:46193425-46193447 AATAACTTAAAGAGTATAATTGG + Intronic
1184758321 22:46529883-46529905 AATAACTAAAAGAGTATAATTGG + Intronic
1184929078 22:47667328-47667350 ATTCACTAAGAGAGAATTAGGGG - Intergenic
1184941526 22:47769641-47769663 AATAACTAAAAGAATATAATTGG - Intergenic
1185209127 22:49557707-49557729 ATTTACTAAGAGCGTATCATGGG - Intronic
949110346 3:253419-253441 AATAAGCAAGAAAGTCTCAGAGG + Intronic
949703251 3:6783913-6783935 AATAACTACAAGAGTATGACTGG - Intronic
949842242 3:8332391-8332413 AATAAATAAAACAGTTTCAGAGG + Intergenic
950061162 3:10072125-10072147 AATAACTAAAATAGTATAATTGG + Intronic
950927154 3:16752937-16752959 AATAACTAAAAGAGTACAATTGG - Intergenic
951069833 3:18314458-18314480 AATAACTAAAAGAGTAAAATTGG - Intronic
951134028 3:19082438-19082460 AATAACTAAAAGAGTATAATTGG - Intergenic
951176158 3:19602812-19602834 AATAACTAAAAGAGAATAATTGG + Intergenic
951177327 3:19617185-19617207 AATAACTAAAAGAGTGTAACTGG - Intergenic
951270826 3:20621662-20621684 AATAACTAAAAGAATATCATTGG - Intergenic
951279172 3:20726199-20726221 AATAACTGAAAGAGTATAACTGG - Intergenic
951336538 3:21429645-21429667 AATTACAAAGAAAGTTTCAGAGG + Intronic
951478010 3:23129230-23129252 AGTAAGTAACAGAGTATCATAGG + Intergenic
951517265 3:23574362-23574384 AATAACTAAAAGAGTACAACTGG + Intronic
952211080 3:31230096-31230118 AATAACTAAAATAGTATAATTGG + Intergenic
952497766 3:33931052-33931074 AATAACTTAGGCTGTATCAGTGG - Intergenic
952676704 3:36040469-36040491 AATAACTAAAAGAGTATTACTGG - Intergenic
952739530 3:36722337-36722359 AATAACTAAAAGGGTATAATTGG + Intronic
952853332 3:37747398-37747420 AGTAACTAAAAGAGTATAATTGG - Intronic
953012183 3:39037463-39037485 AATAACTAAGGGAGTACAATTGG + Intergenic
953044686 3:39283943-39283965 AATAACTAAAAGAGTATGATTGG + Intergenic
953046880 3:39301478-39301500 AATAACTAAAAGAGCATAATTGG + Intergenic
953241005 3:41149521-41149543 GATAACTAAGGGTGTAGCAGTGG + Intergenic
953316941 3:41936896-41936918 AATAACTAAAAGAATATAATTGG + Intronic
953353913 3:42238120-42238142 AATAACTAAAAGAGTAAAAGTGG + Intergenic
953380313 3:42466087-42466109 AATAACTAAAAGAGTATAAGTGG + Intergenic
953590249 3:44245026-44245048 AATAACTAAGAATTTTTCAGAGG + Exonic
953736856 3:45502088-45502110 AATAACTAAAAGAGTATAATTGG - Intronic
953740793 3:45537501-45537523 AAAAACTATCAGAGCATCAGTGG - Intronic
954313757 3:49789599-49789621 AATAACTGAAAGAGTATAATTGG + Intergenic
955028518 3:55193428-55193450 AATAACTAAAAGAGTATGATTGG - Intergenic
955094978 3:55788262-55788284 AAGAACTCTGAGATTATCAGGGG - Intronic
955249370 3:57263273-57263295 AATAACTAAAAGAGTATAATTGG - Intronic
955277902 3:57565464-57565486 AATAACTGAGAGAGTACAATTGG - Exonic
955460201 3:59173865-59173887 ATTAACTAAAAGAGTATAATTGG - Intergenic
955481053 3:59390828-59390850 AATAACTTAAAGAGTGTCATTGG - Intergenic
955577725 3:60384539-60384561 AATGACTAATAAACTATCAGGGG - Intronic
956237462 3:67090182-67090204 AATAACTAAAAGAATATAATTGG + Intergenic
956318129 3:67962333-67962355 AATAACTAAAAGAGTATAACAGG + Intergenic
956550931 3:70458781-70458803 AATAACTGACAGAGTATAATTGG + Intergenic
956567092 3:70651300-70651322 AATAACTAAAAGAGTATAATTGG + Intergenic
956671703 3:71697431-71697453 AATAACTAAAAGAGTAGAATTGG - Intronic
957088189 3:75702602-75702624 AAAAACTAAAAGAGTATAATTGG + Intergenic
957238363 3:77624749-77624771 AATAACTAACAGCATTTCAGGGG - Intronic
957332998 3:78790471-78790493 AATAACTAAGAGAGTATAACTGG - Intronic
957385713 3:79493853-79493875 AATAACTGAGGCAGTATCACTGG - Intronic
957421074 3:79970951-79970973 AATAACTAAAAGAGTAGAACTGG + Intergenic
957612339 3:82484334-82484356 AATAACTAAAAAAGTATAATTGG - Intergenic
957686432 3:83508114-83508136 AATAACTAAAAGAGTATAATTGG + Intergenic
957903561 3:86530061-86530083 AATAAATAAAAGAGTATAATTGG + Intergenic
957914820 3:86675352-86675374 AATAACTAGAAGAGTATAATTGG - Intergenic
958039035 3:88204262-88204284 AATAACTAAAAGAGCATAATTGG + Intergenic
958043573 3:88255173-88255195 AATAACTAAAAGACTATAAGTGG - Intergenic
958084549 3:88789606-88789628 TATAACTAAAAGAGTATAATTGG - Intergenic
958091527 3:88882811-88882833 AGTAACTAAAAGAGTATAATTGG + Intergenic
958137743 3:89518647-89518669 AATAACTAAAAGAGTATAATTGG - Intergenic
958669979 3:97191324-97191346 AATAACTAAAAGAGTATAATTGG - Intronic
958756185 3:98252066-98252088 AATAACTGAAAGAGTATAAGTGG - Intergenic
958840444 3:99197889-99197911 AATAACTAAAAGATTATAATTGG + Intergenic
958920205 3:100096750-100096772 AATAACTGAAAGAGTATAATTGG + Intronic
959259488 3:104057136-104057158 AATAACCAAAAGAGTATAATTGG + Intergenic
959336405 3:105070699-105070721 TATAACTAAGAGAATATAATTGG + Intergenic
959414408 3:106066361-106066383 AATAACTATAAGAGTATAATTGG + Intergenic
959509689 3:107196671-107196693 AGTAACTAAAAGAGTATAATTGG + Intergenic
959546878 3:107606800-107606822 AATAACTAAAAGAGTATAATCGG - Intronic
959772467 3:110116048-110116070 AATAACTAAAAGAGTATATCTGG - Intergenic
959827584 3:110817547-110817569 AATAACTAAAAGAATATAATTGG - Intergenic
959971566 3:112415850-112415872 AATAACGAAAAGAGTATAATAGG - Intergenic
960059062 3:113300345-113300367 AATAACTAAAAGAGTATAATCGG + Intronic
960067692 3:113392543-113392565 AATAACTAAAAGAGTATGAGTGG + Intronic
960079882 3:113530175-113530197 AATCACTAAAAGAGTATAATTGG + Intergenic
960330664 3:116356569-116356591 AATAACTGAGAGAGTACAATTGG + Intronic
960542512 3:118877191-118877213 AATAACGAAAAGAGTATAATTGG - Intergenic
960544560 3:118898759-118898781 AATAACTAAAAGAGTAAAATTGG + Intergenic
960645669 3:119879503-119879525 AATACCTAAAAGAGTATAATTGG - Intronic
960733788 3:120755633-120755655 AATAACTAAAATAGTATAATTGG - Intronic
961611074 3:128140011-128140033 AATAACTAAAAGAGTATAATTGG + Intronic
961771478 3:129253250-129253272 AATAAACAAGAGAGTACAAGCGG + Intronic
961982510 3:131095878-131095900 AATAATTAAAATAGGATCAGAGG + Intronic
962037851 3:131671822-131671844 AATAACCAAAACAGTATAAGTGG - Intronic
962152073 3:132903548-132903570 AATAACTTAAAGAGTATAATCGG + Intergenic
962194039 3:133342347-133342369 AATAACTAAAAGAGTATAACTGG + Intronic
962305951 3:134286383-134286405 AATAACTAAAAGAGTATAATTGG + Intergenic
962430272 3:135312506-135312528 ATTAATGAAGAGAGTCTCAGAGG - Intergenic
962484483 3:135829139-135829161 AATAACTAAAATAGTATAATTGG + Intergenic
962605364 3:137028453-137028475 AATAACCAAAAGAGTATAATTGG + Intergenic
962632265 3:137290329-137290351 AATAACTGAAAGAGTATAATTGG - Intergenic
962775228 3:138652732-138652754 AATAACTAAAAGAGTATAACTGG + Exonic
962816758 3:139007115-139007137 AATAACTAAAAGAGTATAATTGG - Intronic
962870174 3:139481934-139481956 AATAACCAAAAGAGTATAACTGG - Intergenic
963064359 3:141251929-141251951 ACTTACTGAGAGCGTATCAGAGG + Intronic
963220822 3:142809932-142809954 AATAAATAAGAAAATAACAGTGG + Intergenic
963261513 3:143196425-143196447 AATAACTAAAAGAATATAATTGG - Intergenic
963402599 3:144819969-144819991 GAGAAATAAGAGAGTAGCAGTGG - Intergenic
963701906 3:148637228-148637250 AATAACTAAGGGAGTACAACTGG + Intergenic
963858707 3:150284029-150284051 AATAACTAAAAGACTATAATTGG + Intergenic
963969947 3:151419036-151419058 AATCACTAAAAGAGTAGAAGTGG - Intronic
964157913 3:153608212-153608234 AATAACTAAAAAAGTATAACTGG + Intergenic
964194693 3:154049122-154049144 AATAACTAAAAGAGTGTAATTGG + Intergenic
964267482 3:154915217-154915239 AATAACTAAATGAGTATAATTGG + Intergenic
964521101 3:157568419-157568441 AATAACTAAAAGAGTATAAGTGG - Intronic
964586556 3:158312638-158312660 AATCAGTAAGAAATTATCAGTGG + Intronic
964873090 3:161334752-161334774 AATAACTATAAGAGTATAATTGG + Intergenic
964938212 3:162121442-162121464 AATAACTAAAAGAGTATAATAGG - Intergenic
965035968 3:163438564-163438586 AATAACTAAAAGAGTATAATTGG + Intergenic
965174492 3:165314319-165314341 AATAACTCAGAGAGTATAATCGG - Intergenic
965359197 3:167716394-167716416 AATAACTAAAAGAGTATAACTGG + Intronic
965456338 3:168905590-168905612 AATAAATAAGACAGTATCTGTGG - Intergenic
965456463 3:168907342-168907364 AATAAATAAGAGAGTATCTGTGG + Intergenic
965579525 3:170252493-170252515 AATAACTAAAAGAGTATAATTGG - Intronic
965629842 3:170721416-170721438 AGTAACTAAAAGAGTATCATTGG + Intronic
965786241 3:172338339-172338361 ATAAGCAAAGAGAGTATCAGAGG + Intronic
965793764 3:172416523-172416545 AGTAACTAAAAGAGTATAATTGG - Intergenic
965892037 3:173526607-173526629 AATCACTAAAAGAGTATAATTGG - Intronic
965974172 3:174601074-174601096 AATAACTGAAAGAGTATAATTGG - Intronic
966046480 3:175557402-175557424 AATAACTAAAAGAGTTTAATTGG - Intronic
966094286 3:176179949-176179971 AATAACTAAAAGAATATAATTGG + Intergenic
966324443 3:178738530-178738552 AACAACTTAGAGAATACCAGTGG - Intronic
966349061 3:179011363-179011385 AATAACTAAAAGAGTATAATTGG + Intergenic
966429676 3:179818449-179818471 AATAACTAAAACAGTATAATTGG - Intronic
966452342 3:180076590-180076612 AATAACTAAAAGAGTATAATTGG + Intergenic
966458781 3:180150302-180150324 AATAACTAAAAGAGTATAATTGG - Intergenic
966464142 3:180211048-180211070 AATAACTAAAAGAATATAATTGG + Intergenic
966468716 3:180262891-180262913 AATAACTAAAAGAGTATAACTGG + Intergenic
966479153 3:180385927-180385949 AAGAACTAAAAGAGACTCAGTGG + Intergenic
966779181 3:183568971-183568993 AATAACTTAAAGAGTATAATTGG - Intergenic
967265794 3:187691173-187691195 AATAAACAAGTGAGTACCAGAGG - Intergenic
967609642 3:191489062-191489084 AATAACTAAAAGAGTATAATTGG + Intergenic
967702378 3:192608283-192608305 AATAACTAAAAGAGTATAATTGG + Intronic
967715365 3:192756462-192756484 AAGAACTAAAAGAGTATAATTGG + Intronic
967749072 3:193093209-193093231 AATAACTAAAATAGTATAACTGG + Intergenic
967849073 3:194068976-194068998 AATAACTGAAAGAGTATAATTGG + Intergenic
968292708 3:197551069-197551091 AATAACTAAAAGAGTATAATTGG - Intronic
968300696 3:197611753-197611775 AATAACTAAAAGAGTATAACTGG + Intergenic
968325697 3:197813236-197813258 AATAATTAAAAGAGTATAAATGG - Intronic
968330068 3:197860754-197860776 AATAACTAAAGGAGTATAACTGG - Intronic
968395904 4:237862-237884 AATAACTAAAAGAGCATAATTGG - Intergenic
969142288 4:5088440-5088462 AATAACTAAAAGAATATAATTGG + Intronic
969142298 4:5088595-5088617 AATAACTAAAATAGTATAATTGG + Intronic
969827088 4:9766197-9766219 AATAACTAAAAGAGTGTAATTGG + Intergenic
970076546 4:12228278-12228300 AATAACTAAAAGAGTATAATTGG - Intergenic
970212465 4:13724326-13724348 AATAACTTAAAGAGTATAACTGG - Intergenic
970377537 4:15474575-15474597 AATAACTAAAAGAGTATAAATGG + Intronic
970735578 4:19163476-19163498 AATAACTTAAAGAGTATAATTGG - Intergenic
970850404 4:20595926-20595948 AATAACTAAAAGAGTATAACTGG + Intronic
971523674 4:27587935-27587957 AATAACTATAAGAGTATAATTGG + Intergenic
972005203 4:34093482-34093504 AATAAGTAAAAGAGTATAATTGG + Intergenic
972005551 4:34099293-34099315 AATAACTAAAAGAGTGTAATTGG - Intergenic
972124976 4:35753181-35753203 AATAACTAAAAGAGCATAATTGG - Intergenic
972148583 4:36061214-36061236 AATAACTAAAAGAGTATAACTGG - Intronic
972208445 4:36806579-36806601 GATAACTAAAAGAGTATAATTGG - Intergenic
972686362 4:41357393-41357415 AAAAACTAAAAGAGTATAATTGG + Intergenic
972753289 4:42015039-42015061 AATAACTAAAAGAGTATAATTGG + Intronic
972905162 4:43736895-43736917 AATAACTATAAGAGTATAATTGG + Intergenic
972928885 4:44047034-44047056 AATAACTAAAAGAGTACGATTGG + Intergenic
973042776 4:45493575-45493597 AATAACTAAAATAGTATAATTGG - Intergenic
973054330 4:45635788-45635810 AATAACTAAAAGAGTGTAATTGG + Intergenic
973088056 4:46093578-46093600 AATAACCAAAAGAGTATAACTGG + Intronic
973326090 4:48863566-48863588 AACAACTAAAAGAGTATAATTGG - Intergenic
973853341 4:54984484-54984506 AATAACTAAAAGAATATAATTGG + Intergenic
973880496 4:55266917-55266939 AATAACTAAAAGAGTTTAATTGG + Intergenic
974292798 4:59955312-59955334 AATAACTAAAAGACTATAATTGG + Intergenic
974517089 4:62931044-62931066 AACAAATAGGAGAGAATCAGTGG + Intergenic
974677839 4:65117859-65117881 AATAACTAAGAGAATATAATTGG + Intergenic
974887694 4:67840653-67840675 AATAACTAAAAGAATATAATTGG + Intronic
975176194 4:71292014-71292036 AATAACTAAAAGAGTATGACTGG - Intronic
975179467 4:71327837-71327859 TATAACTAAAAGAGTATAATTGG - Intronic
975286016 4:72621191-72621213 AATAACTAAAAGAGTATAATTGG + Intergenic
975336082 4:73176698-73176720 AATAACTAAAAAAGTATAACTGG + Intronic
975463074 4:74677316-74677338 AATAGCTAAAAGAGTATAATTGG - Intergenic
975463623 4:74684292-74684314 AATAACTAAAAATGTATCACAGG - Intergenic
975591269 4:76002428-76002450 AATAAGTAAGAGGTTACCAGAGG + Exonic
975630289 4:76394614-76394636 AATAACTAAAAGAATATAATTGG + Intronic
975674660 4:76814113-76814135 AATAACTATAAGAGTATAATTGG - Intergenic
975754134 4:77555979-77556001 AATATATGAGAGAGTTTCAGTGG - Intronic
975840344 4:78467086-78467108 AATAACTAAAAGAGAATAACTGG - Intronic
975841576 4:78480085-78480107 AATAACTAAAAGAGTATAATTGG - Intronic
976128959 4:81863910-81863932 ACTAACTAAAAGAGTATAATTGG + Intronic
976151440 4:82096503-82096525 AATAACTAAACGAGTATAATTGG + Intergenic
976158112 4:82169629-82169651 AATAACTAAAAGAGTATAATTGG + Intergenic
976227727 4:82809501-82809523 AATAACTAAAGGAGTATAACTGG + Intergenic
976358109 4:84144604-84144626 AAAAACTAAGAAAGTAACATTGG - Intergenic
976516325 4:85971623-85971645 AATAACTAAAACAGTATAATTGG - Intronic
976669349 4:87635065-87635087 GATAACTAAAAGAGTATAATTGG - Intergenic
976745517 4:88399468-88399490 AATAAATAAGATTGTATTAGAGG + Intronic
976880989 4:89925018-89925040 AATAACTAAGAGAATATAATTGG - Intronic
976907128 4:90252632-90252654 AATAACTAAAATAATATAAGTGG - Intronic
976913801 4:90343892-90343914 AACAACTAAAAGAGTATAATTGG - Intronic
976953738 4:90867545-90867567 AATAACTAAAAGAATATAATTGG - Intronic
976953784 4:90868200-90868222 AATAACTTAAAGAGTATAACCGG - Intronic
977055412 4:92184146-92184168 AATAACTAAAAGGGTATGATAGG + Intergenic
977166309 4:93703406-93703428 AATAACTCAAAGAGTATAATTGG - Intronic
977186052 4:93937854-93937876 AATAACTAAACGAGTATAATTGG + Intergenic
977265407 4:94847904-94847926 AAAAACTAAAAGAGTATAATTGG + Intronic
977402932 4:96557018-96557040 AATATCTTGGAAAGTATCAGTGG + Intergenic
977418993 4:96773641-96773663 GATAACTAAGAGAGAAAAAGAGG + Intergenic
977522268 4:98099881-98099903 AATAACTACAAGAGTATAATTGG + Intronic
977631763 4:99250830-99250852 AATAACTAAAGGAGTATAATTGG + Intergenic
977857489 4:101911385-101911407 AATAATGAAAAGAGTATCTGAGG - Intronic
977859427 4:101938431-101938453 AATAACTAAAAAAGTATAACTGG + Intronic
977873090 4:102116855-102116877 AATAACTAAAAGAGTATAACTGG - Intergenic
977978024 4:103289432-103289454 AGTAAGAAAGAGAGTAACAGAGG + Intergenic
978062847 4:104359454-104359476 AGTAACTAAAAGAGTATAATTGG + Intergenic
978162566 4:105566567-105566589 AATATCTAAGAGAGTATAACTGG - Intronic
978262048 4:106771651-106771673 AATAACTAAATGAGTATAATTGG + Intergenic
978400193 4:108323012-108323034 AATAACTAAAAGAGTATAATTGG + Intergenic
978547235 4:109884079-109884101 AATAACTAAAAGAGTATAATTGG + Intergenic
978584342 4:110261606-110261628 AATAACTACAAGAGTATAATTGG - Intergenic
978650704 4:111000988-111001010 AATAACTAAAAGAGTATAACTGG + Intergenic
978655213 4:111057957-111057979 AATAACTAAAAGAGTACAATTGG + Intergenic
978733933 4:112063782-112063804 AACAACTAAAAGAGTATAACTGG + Intergenic
978799902 4:112745446-112745468 AATAACTAAAAGAGCATAATTGG - Intergenic
978829136 4:113061838-113061860 AATAACTGAAAGAGTATAATTGG + Intronic
978933757 4:114350601-114350623 AATAACTAAAAGAGTATAACTGG - Intergenic
979073195 4:116238449-116238471 AATAACTAATAGAGTGTAATTGG - Intergenic
979091391 4:116487509-116487531 AATACCTAAAACAGTATAAGTGG - Intergenic
979105217 4:116677145-116677167 AGAAAATAAGATAGTATCAGAGG - Intergenic
979129268 4:117020099-117020121 AATAACTAAAAGAGTATAAGTGG + Intergenic
979307109 4:119158942-119158964 AATAACTAAAAGAGTATAACTGG + Intronic
979322375 4:119339239-119339261 AATAACTAAAAGAGTATAACTGG - Intergenic
979395571 4:120184558-120184580 AATAACTAAAATAGTATAATTGG + Intergenic
979610705 4:122686012-122686034 AATAACTAAAAGAGCATAATTGG + Intergenic
979611768 4:122697038-122697060 AGTAACTAAAAGAGTATAATTGG + Intergenic
979677434 4:123425400-123425422 AATAACTAAAAGAGTATAATTGG - Intergenic
979707237 4:123735129-123735151 AGTAACTAAAAGAGTATAATTGG + Intergenic
979897845 4:126182685-126182707 AACAACTATTAGAGTAGCAGAGG + Intergenic
979912746 4:126390202-126390224 AATAACTAAAAGAGTACAATTGG - Intergenic
979922074 4:126510494-126510516 AATAACTAAAAGAGCATAATTGG + Intergenic
980443674 4:132880565-132880587 AATTACTAAAAGAGTATAATTGG + Intergenic
980502622 4:133675803-133675825 AATGACTATGAGAGTATTGGGGG + Intergenic
980531460 4:134061062-134061084 AATAACTAAAAGAGTATAATTGG + Intergenic
980799201 4:137727061-137727083 AATAACTAAAAGAGTAGAATTGG - Intergenic
981101950 4:140838833-140838855 AAGAACTAAGAAAGTATTTGTGG - Intergenic
981249935 4:142587686-142587708 AATAACTAAAAGAGTATAATAGG - Intronic
981287300 4:143033364-143033386 AATAACTAATAGAGTATAATTGG + Intergenic
981530215 4:145745222-145745244 AATAACTAAAAGAGAATAATTGG - Intronic
981558171 4:146017812-146017834 AATAACTAAAAGAGTATAATTGG - Intergenic
981591244 4:146364760-146364782 AATAACTAAAAGAGTAAAATTGG + Intronic
981681373 4:147403292-147403314 AATAATTAACAGAGTATAATTGG - Intergenic
981738082 4:147973541-147973563 AATAACTAAAAGAGTATAACTGG - Intronic
981776272 4:148371191-148371213 AATAACTCAAAGAGTATAATTGG - Intronic
981883170 4:149640296-149640318 AGTAACTAATAGAGTATAACTGG - Intergenic
982352083 4:154426801-154426823 AATAACTAAAAGAGTATAATTGG + Intronic
982933203 4:161435562-161435584 AATAACTAAAAGAGTATAACTGG + Intronic
983240350 4:165224853-165224875 AATAACTAAAAGATTATAACTGG - Intronic
983486201 4:168333512-168333534 AATAACTAAAAGAGTATAATTGG + Intergenic
983493385 4:168414991-168415013 AATAACTAAAAGAGTAGAATTGG + Intronic
983807523 4:172013710-172013732 AATAACTAAAACAGTATAATTGG - Intronic
983868393 4:172795689-172795711 AATAACTAAGAGAATGTAATTGG - Intronic
984119928 4:175729579-175729601 AATAACTAAAAGAGTATAAGTGG + Intronic
984289780 4:177781123-177781145 AATAACTAAAAGAGTATAAGTGG + Intronic
984473308 4:180204509-180204531 AATAACTAAAAGAGTATAACTGG - Intergenic
984505793 4:180616679-180616701 AATAACTAAAAGAGTATAATTGG + Intergenic
984517268 4:180756270-180756292 AATAACTTACAGAGTGTCATTGG - Intergenic
984586703 4:181572744-181572766 AATAACTAAAAGAGTATAACTGG - Intergenic
985195412 4:187423356-187423378 AATAACTAAAAGAGTATAATTGG - Intergenic
985393090 4:189512691-189512713 ATAAACTAAGAAAGTCTCAGTGG + Intergenic
985689952 5:1302206-1302228 AATAACTAAAAGAGTATAATTGG - Intergenic
986084501 5:4430701-4430723 AGTAACTAAAATAGTATCATTGG - Intergenic
986544082 5:8876234-8876256 AATAACTAAAATAGTATAATTGG - Intergenic
986757193 5:10848877-10848899 AATAACTAAAAAAGTATAACTGG + Intergenic
986879197 5:12149133-12149155 AATAACTAAAAGAGTATAATTGG - Intergenic
986996041 5:13608483-13608505 AATAACTAAAAGAGTATAATTGG + Intergenic
987003501 5:13685844-13685866 AATAACTAGAAGAGTATAACTGG - Intergenic
987189046 5:15454613-15454635 AATAACTAAAAGAGTGTAATTGG - Intergenic
987327448 5:16825261-16825283 AATAAGGAAGAGAGTGGCAGGGG - Intronic
987433803 5:17868401-17868423 AATAACTAAAAGAATATAATTGG - Intergenic
987475505 5:18387480-18387502 AATAACTAAAAAAGTATAATTGG - Intergenic
987920592 5:24275010-24275032 AATAACTAAAAGAGTATAATTGG + Intergenic
987925794 5:24340089-24340111 AAAAACTAATAGAATATCTGAGG - Intergenic
987971778 5:24955594-24955616 AAGAACTAACACACTATCAGGGG - Intergenic
988005124 5:25400915-25400937 AATAACTAAAAGAGTATAATAGG - Intergenic
988083334 5:26441085-26441107 AATAACTGAAAGAGTATAATTGG + Intergenic
988118640 5:26929975-26929997 AATAACTAAAAGAGTATAATTGG + Intronic
988153577 5:27419238-27419260 AATAACTAAAAGAGTATAATTGG - Intergenic
988376706 5:30444659-30444681 AATAACTAAAAGAATATAATTGG + Intergenic
988564505 5:32310767-32310789 AATAACTTAAAGAGTATAATTGG + Intronic
988607739 5:32694706-32694728 AATAACTAAAACAGTATAATTGG - Intronic
988947784 5:36223816-36223838 AATAACCAAGAGAGTGACACAGG + Intronic
988977004 5:36525720-36525742 AATAACTAAAAGAGTATAATTGG + Intergenic
989071622 5:37517814-37517836 AATAACTAAAAGAGTTTAACTGG - Intronic
989322906 5:40157545-40157567 AGTAACTAAAAGAGTATAATTGG - Intergenic
989449838 5:41573614-41573636 AATAACAAAGAGATTATCCCTGG + Intergenic
989658862 5:43776568-43776590 AATAACTAAGACAGTATAAGCGG - Intergenic
989673124 5:43943037-43943059 AATAACTAAAAGAGTATAATTGG + Intergenic
989690245 5:44134708-44134730 AATAACTAAAAGAGTATAATTGG - Intergenic
989779758 5:45249812-45249834 AATAATTAAAAGAGTATAATTGG - Intergenic
989786075 5:45332338-45332360 AATAACTAAAAGAGTATAATTGG - Intronic
989974807 5:50572182-50572204 AATAACTGAAAGAGTATAATTGG + Intergenic
990011806 5:51008388-51008410 AATAACTAAAAGAGTATAATTGG - Intergenic
990202553 5:53394362-53394384 AATAACTAAAAGAGTATAATTGG - Intergenic
990283719 5:54278682-54278704 AAAAACTTAGACATTATCAGTGG - Intronic
990524566 5:56612175-56612197 AATAACTAAAAGAGTATAATTGG + Intergenic
990647901 5:57865219-57865241 AATAACTAAAAGAGTATAATTGG - Intergenic
990854282 5:60245913-60245935 AATAACTAAAAGAGTATAATTGG + Intronic
990923141 5:60990275-60990297 AATAACTAAAAGAGTATAACTGG + Intronic
990963598 5:61420818-61420840 AATAACTAAAAGAGTATAACAGG - Intronic
991216220 5:64159731-64159753 AATAACTAAACGAGCATCAAAGG - Intergenic
991297379 5:65095248-65095270 AATAACTAAAAGATTATAATTGG + Intergenic
991360056 5:65810606-65810628 AATAACTAAAAGAGTGCAAGTGG - Intronic
991537102 5:67681660-67681682 AATAACTAAAAGAGTATAATTGG - Intergenic
991545422 5:67776782-67776804 AGTAACTAAAAGAGTATAATTGG - Intergenic
991922684 5:71672359-71672381 AATAACTAAAAGAGCATAATTGG - Intergenic
992343845 5:75855804-75855826 AATAACTAGAAGAGTATAACTGG - Intergenic
992755072 5:79896473-79896495 AATAACTAAAAGAGTATAATTGG - Intergenic
992785412 5:80166111-80166133 AATAACTAAAAGAGTATAATTGG - Intronic
992840249 5:80682730-80682752 AATAACTAAAAGAGTATAATTGG - Intronic
992846742 5:80757237-80757259 AATAACTAGAAGAGTATAATGGG - Intronic
993139133 5:84008270-84008292 AATAACTAAAAGATTATCATTGG + Intronic
993155794 5:84220094-84220116 AATAACTAAAAGAGTATAATTGG + Intronic
993268734 5:85764803-85764825 AATAACTAAAAGAGTATCATTGG - Intergenic
993337162 5:86674499-86674521 AATAACTAAAAGAGTATAATTGG + Intergenic
993537846 5:89108929-89108951 AATAACTTGAAGAGTATAAGTGG + Intergenic
993958920 5:94272326-94272348 AATAACTAAAAGAGTATCACTGG + Intronic
994034961 5:95187855-95187877 AATAACTGAAAGAGTATAATTGG + Intronic
994226733 5:97260728-97260750 AATAACTAAAACAGTATAATTGG + Intergenic
994265454 5:97710772-97710794 AGTAACTAAAAGAGTATAACTGG + Intergenic
994475047 5:100257021-100257043 AATAACTAAAAGAGTATAACTGG - Intergenic
994602890 5:101929221-101929243 AATAACTAAAAGAGTCTAATTGG + Intergenic
994728166 5:103461045-103461067 AATAACTAAAAGAGTGTAATTGG + Intergenic
994854291 5:105097441-105097463 AATAACTAGAAGAGTATGATTGG + Intergenic
994877230 5:105439767-105439789 TATAACTAAAAGAGTAAAAGTGG + Intergenic
994891623 5:105642849-105642871 AATAACTAAAAGAGTAGGACTGG + Intergenic
995154073 5:108889649-108889671 AATAACTAAAAGAGTATAATAGG + Intronic
995243023 5:109906557-109906579 AATAACTAAAAGAGTATAATTGG - Intergenic
995288999 5:110427994-110428016 AATAACTAAAAAAGTATAATTGG - Intronic
995311163 5:110713387-110713409 AATAACTAAAGGAGTATAATTGG + Intronic
995771148 5:115671828-115671850 AATAACTAAAAGTGTATAATTGG + Intergenic
995890869 5:116949290-116949312 AATAACTAAAAGAGTATAATTGG - Intergenic
996135596 5:119838087-119838109 AATAACTAAAAGAGTAAAATTGG - Intergenic
996189709 5:120524664-120524686 AATACCTAAAAGAGTATAATTGG + Intronic
996192147 5:120558147-120558169 AAGAACTAAAAGAGTATAATTGG - Intronic
996210301 5:120799901-120799923 AATAACTAAAAGAGTGTAATTGG + Intergenic
996241703 5:121211879-121211901 AATAACTAAAAGAGTATAATTGG - Intergenic
996298668 5:121955007-121955029 AATAACCAAAAGAGTATAATTGG - Intergenic
996460361 5:123733864-123733886 AACAACTAAAATAGTATCATAGG - Intergenic
996610128 5:125368765-125368787 AATAACTAAAAGAGTGTAATTGG - Intergenic
996828969 5:127718906-127718928 AATAACTAAAAGAGTATAATTGG - Intergenic
996906016 5:128601293-128601315 AATAACTAAAAGAATATAACTGG - Intronic
997060469 5:130495516-130495538 CATAACTAAAAGAGTATAATTGG + Intergenic
997083756 5:130771835-130771857 AATAACTAAAAGAGTATAATTGG + Intergenic
997098086 5:130936516-130936538 AATAACTAAAAGATTAAAAGTGG + Intergenic
997591796 5:135078141-135078163 GATAACTAAGAAATTAGCAGTGG - Intronic
997688907 5:135812319-135812341 AATAACTAAAAAAGTATAAATGG - Intergenic
997709088 5:135988225-135988247 AGTAACTAAAAGAGTATAATTGG - Intergenic
997782347 5:136672780-136672802 AATAACTAAAAGAGTATAATTGG - Intergenic
997833076 5:137169319-137169341 AATAACTAAAAGAGCATAATTGG + Intronic
997876971 5:137558285-137558307 AATAACCAAAAGAGTATAATTGG + Intronic
997987660 5:138516211-138516233 AATAACTCAAAGAGTATAACTGG + Intronic
998058501 5:139099914-139099936 AATAACTAAAAGAGTATAACTGG + Intronic
998264382 5:140656772-140656794 AACAACTAAAAGAGTATAAATGG - Intronic
998289215 5:140896979-140897001 AATAACTAAAAGAGCATAACTGG - Intronic
999104102 5:149054027-149054049 AATAACTAAAAGAGTATAATTGG + Intronic
999106904 5:149080179-149080201 AATCACTAAGACAGTAAGAGAGG + Intergenic
999530515 5:152458022-152458044 AATAACTAAAAGAGTGTAATTGG - Intergenic
999667658 5:153930593-153930615 AATAATTAAAAGAGTATGATTGG + Intergenic
999682208 5:154070825-154070847 AATAACTAAAAGAGTGTGAGTGG + Intronic
999918976 5:156297157-156297179 AATAACTAAGAGAGTATCAGTGG - Intronic
1000129893 5:158286774-158286796 AATAACTAAGAGAGTGGAATTGG - Intergenic
1000487107 5:161860621-161860643 AATAACTAAAAGAGTATAATTGG + Intronic
1000497076 5:161997720-161997742 AATAACTAAAAGAGTATAATTGG + Intergenic
1000531908 5:162433202-162433224 AATAACTAAAAGAGTTTAATTGG - Intergenic
1000577916 5:162998353-162998375 AATAACTGAAAGAGTATTACTGG + Intergenic
1000685746 5:164246986-164247008 AATAACTAAAAGTGTATAATTGG - Intergenic
1000769098 5:165328998-165329020 AATAAAGAAGAGAGTTTCAATGG - Intergenic
1001178240 5:169493207-169493229 AATAACTAAAAGAGTATAATTGG + Intergenic
1001199657 5:169704625-169704647 AACAACTAAAAGAGTATGATTGG + Intronic
1001807407 5:174599431-174599453 AATAACTAACAGAGTATAATTGG + Intergenic
1001814106 5:174653532-174653554 AATAACTGAAAGAGTGTCATTGG + Intergenic
1001862121 5:175066430-175066452 AAGGACTAAGAGATTATGAGAGG - Intergenic
1002736427 5:181391268-181391290 AATAACTGAAAGAGTATAATTGG - Intergenic
1002748270 6:83556-83578 AATAACTGAAAGAGTATAATTGG + Intergenic
1002766563 6:244971-244993 AATAACTAAAAGATTATAATTGG + Intergenic
1003126530 6:3360662-3360684 AATAACTGGGACAGTATCTGGGG - Intronic
1003225166 6:4198266-4198288 AATAAATAAAAGAGTATAATTGG - Intergenic
1003402062 6:5798790-5798812 AATAACTAAAAGAGTATAATTGG + Intergenic
1003437578 6:6106369-6106391 AATAACTAAAAGAGTATGAATGG - Intergenic
1003583610 6:7365657-7365679 AAAATCAAAGAGATTATCAGTGG + Intronic
1003702158 6:8479191-8479213 AATAACTAAAAGAGTACAATTGG - Intergenic
1004455313 6:15786510-15786532 AATAACTAAGAGATTGTTATGGG - Intergenic
1004594210 6:17083968-17083990 AATAACTAAAAGAGTAAAATTGG - Intergenic
1004682715 6:17912087-17912109 AATAACTAAAAGAGTATAATTGG + Intronic
1004752225 6:18574207-18574229 AATAACTAAAAGAGTATAATTGG - Intergenic
1005036628 6:21561244-21561266 AATAACTAAAAGAGTATAACTGG - Intergenic
1005156513 6:22813136-22813158 AATAACTAAAAGAGTATAATTGG - Intergenic
1005280343 6:24267284-24267306 AATAACTAAAAGGGTATAATTGG + Intronic
1006571204 6:35006353-35006375 AATAACTAAAAGAGTGTAATTGG + Intronic
1006588733 6:35138721-35138743 AATAACTAAAAGAGTATAATTGG + Intronic
1006740765 6:36306920-36306942 AATAACTATGAGAGGACCTGGGG + Intronic
1007022595 6:38536954-38536976 AATGGCTAAAAGAGTATCACTGG + Intronic
1007552244 6:42739033-42739055 AATAACTAAAAGAGTATCATTGG + Intergenic
1008237532 6:49068448-49068470 AGTAACTAAAAGAGTATAATTGG + Intergenic
1008317555 6:50064374-50064396 AATAACTAAAAAAGTATAATTGG + Intergenic
1008641483 6:53467053-53467075 AATAACTAAAAGAGTATAATTGG - Intergenic
1008809728 6:55481384-55481406 AATAACTAAAAGAGTAGAACTGG + Intronic
1008836447 6:55837658-55837680 AATAACTGAAAGAGTATAATTGG - Intronic
1008891866 6:56503267-56503289 AATAACTAAAAGAGTATAATTGG + Intronic
1009301991 6:62035630-62035652 CATAACTAAAAGAGTATTATTGG + Intronic
1009334322 6:62467180-62467202 AATAACTAAAAGAGTATAATTGG - Intergenic
1009447946 6:63765650-63765672 AATAACTAAGGAAGTATAATTGG - Intronic
1009488820 6:64261033-64261055 AATAACTAAAAGAGTAGAATTGG - Intronic
1009617839 6:66033513-66033535 AATAACTAAAAGAATATAATTGG - Intergenic
1009627558 6:66155361-66155383 AATAACTGAAAGAGTATAATTGG + Intergenic
1009745415 6:67807233-67807255 AATAACTAAAAGAGTATAATTGG + Intergenic
1009765471 6:68069044-68069066 AATGGATAGGAGAGTATCAGAGG + Intergenic
1009789721 6:68386001-68386023 AATTACTACCTGAGTATCAGGGG - Intergenic
1009797000 6:68481901-68481923 AATAACTAAAAGACTATAATTGG + Intergenic
1009943048 6:70311661-70311683 AATAACTAAAAGAGTACAACTGG + Intergenic
1010013315 6:71074991-71075013 AATAACTAAAAGAGTATAATTGG + Intergenic
1010251911 6:73715774-73715796 AATAACTAAAATAGTATAACTGG - Intronic
1010548528 6:77189871-77189893 AATAACTAAAAGTGTATAACTGG + Intergenic
1010559493 6:77332692-77332714 AATAACTAAAAGAATATAATTGG - Intergenic
1010776050 6:79887223-79887245 AATAACTAAAAGAGTGTAATCGG + Intergenic
1010920586 6:81675100-81675122 AATAACTAAAAGAGTGTAATTGG + Intronic
1011013912 6:82733990-82734012 AATAACTAAAGGAGTATAATTGG - Intergenic
1011024943 6:82857438-82857460 AATAACTAAAAGAATATAATTGG + Intergenic
1011033719 6:82951088-82951110 AATAACTAAAAGAGTATAAGTGG + Intronic
1011061286 6:83272011-83272033 AATAACTAAGAGAGTATAATTGG - Intronic
1011102292 6:83736692-83736714 AATAACTAAAATAGTATGATTGG - Intergenic
1011102336 6:83737057-83737079 AATAACTAGAAGAGTATGATTGG - Intergenic
1011236467 6:85223843-85223865 AATAACTAAAAGAATATAATTGG + Intergenic
1011248234 6:85342266-85342288 AATAACTAAAAGAGTATAATTGG - Intergenic
1011342019 6:86326672-86326694 AATAACTAAAAGTGTATAATTGG + Intergenic
1011520982 6:88205904-88205926 AATAACTCAAAGAGTATAATTGG + Intergenic
1011596068 6:89017682-89017704 AATAACTAAAAAAGTATTATTGG + Intergenic
1011873259 6:91923996-91924018 AATAACTAAAAGAGTATAATTGG + Intergenic
1011984359 6:93424156-93424178 ACTAAGGAAGAGAGTATCTGAGG - Intergenic
1011991494 6:93524585-93524607 AATAACAAATAGAGTTTTAGTGG - Intergenic
1012147153 6:95699344-95699366 TATAATTAAGAGTGTAGCAGTGG - Intergenic
1012148051 6:95710954-95710976 AACAACTAAAAGAGTATAATTGG - Intergenic
1012287858 6:97415074-97415096 AATAACTAAAAGAGTATAATTGG - Intergenic
1012342069 6:98139585-98139607 AATAACTTAAAGAGTATAATCGG + Intergenic
1012485316 6:99715057-99715079 AATAACTAAAAGAGTATAATAGG - Intergenic
1012503838 6:99921628-99921650 AATAACTAAAAGAGTATAATTGG - Intronic
1012645968 6:101681563-101681585 AATAACCAAAAGAGTATAAATGG - Intronic
1012697030 6:102398582-102398604 AATAACTAAAAGATTATAATTGG - Intergenic
1012702997 6:102486961-102486983 AATAACTAAGAGAGTGTAATTGG - Intergenic
1012744803 6:103072231-103072253 AATAACTAAAAGAGTATAATTGG + Intergenic
1012976142 6:105783012-105783034 AATAACTAAAAGAGTATAATTGG - Intergenic
1013042251 6:106447423-106447445 AATAACTAAAAGAATATAATTGG + Intergenic
1013060797 6:106631817-106631839 AATAACTAAAAGAGTATAACTGG - Intronic
1013490783 6:110644499-110644521 AATAACTAAAAGAGTATAATTGG + Intronic
1013685602 6:112577963-112577985 AATAACTAAAAGAGTAGAATTGG + Intergenic
1013687816 6:112605973-112605995 AATAACTAAAAGAGTATAACTGG + Intergenic
1013862125 6:114648411-114648433 AATAACTAAAATAGTATAATTGG - Intergenic
1014275242 6:119380677-119380699 AATAACTAATAGAGTATAATTGG - Intergenic
1014485111 6:121989552-121989574 AATAACTATAAGAGTATAATTGG - Intergenic
1014553348 6:122814563-122814585 AATAACTAAAAGAGTAGAAGTGG - Intergenic
1014617783 6:123625581-123625603 AATAACTAAAAGAGTATAACTGG + Intronic
1014693043 6:124585446-124585468 AATAACTAAAAGAGTATAATTGG + Intronic
1014787133 6:125632017-125632039 AATAACTAAAAGATTATAATTGG - Intergenic
1014864735 6:126514767-126514789 AATAACCAAAAGAGTATAATTGG - Intergenic
1014928966 6:127310224-127310246 AACAACTAAAAGAGTATAATTGG + Intronic
1014943171 6:127466973-127466995 AAATATTAAGAGAGTATGAGGGG - Intronic
1015135255 6:129862071-129862093 AATAACTAAAAGGGTATAATTGG - Intergenic
1015194044 6:130505764-130505786 AATAACTAAAAGAGTACAATTGG + Intergenic
1015199931 6:130568022-130568044 AATAACTAAAAGAGTATAATTGG - Intergenic
1015207469 6:130656220-130656242 AGTAACTAAAAGAGTATAACTGG + Intergenic
1015350942 6:132218960-132218982 AATAACTAAAAGAGTATAATTGG + Intergenic
1015425920 6:133067246-133067268 AATAACTAAAAGAGTGTAATTGG + Intergenic
1015426583 6:133077092-133077114 AATAACTAAAAGAGTATAATTGG + Intergenic
1015602983 6:134928583-134928605 AATCATTCAGAGACTATCAGTGG + Intronic
1015687969 6:135887445-135887467 AATAATTAAGAGAATATGAAAGG + Intronic
1015710691 6:136136549-136136571 AATAACTAAAAGAGTATAACTGG + Intronic
1015743247 6:136481745-136481767 AATAACTAAAAGAGTATAACTGG + Intronic
1015788244 6:136940322-136940344 AACATCCAATAGAGTATCAGAGG - Intergenic
1016075721 6:139793664-139793686 AATAACTAAAACAGTATAATTGG - Intergenic
1016136390 6:140549063-140549085 AATAACTGAAAGAGTATAATTGG - Intergenic
1016365566 6:143313678-143313700 GATAACTAAAAGAGTATAACTGG + Intronic
1016478060 6:144450100-144450122 CACAACTAAGATAGTAACAGTGG - Intronic
1016497597 6:144681990-144682012 AATAACTAAAAAAGTATAATTGG - Intronic
1016542604 6:145182598-145182620 AATAACTAAAAGAGTGTAATTGG + Intergenic
1016631087 6:146232534-146232556 AATAACTAAAAGAGCATAATTGG - Intronic
1016836117 6:148478666-148478688 AATAACTAAAAGATTATAATTGG + Intronic
1016897790 6:149070742-149070764 AATAACTAAAAGAGCATAACTGG - Intronic
1016900833 6:149100100-149100122 AATAACTAAAAGAGCATAACTGG + Intergenic
1017083584 6:150692619-150692641 AATTACTAAATGAATATCAGAGG + Intronic
1017181812 6:151561217-151561239 AATAACTAAAAGAGTATAATTGG - Intronic
1017319264 6:153069598-153069620 AATCACTAAAAGAGTATAATTGG + Intronic
1017579456 6:155846935-155846957 AATAACTAAAATAGTATAATTGG + Intergenic
1017812286 6:157992128-157992150 AATAACTAAAAGAGTATAATTGG - Intronic
1018361454 6:163074541-163074563 AATAACTAAAAGAGCATAATTGG + Intronic
1018536263 6:164823232-164823254 AATAACTAAAAGAGTGTAATTGG + Intergenic
1019044955 6:169138642-169138664 AGTAACTAAAAGAGTATAATTGG + Intergenic
1019130905 6:169873713-169873735 AATAACTAAAAGAATATAATTGG - Intergenic
1019241525 6:170666797-170666819 AATAACTGAAAGAGTATAATTGG - Intergenic
1019850971 7:3556814-3556836 AATAACTAGAAGAGTATAATTGG + Intronic
1020041692 7:5008265-5008287 AATAACTAAAAGAGTATAACTGG - Intronic
1020353755 7:7254295-7254317 AATAACTAAAAGAGTATAATTGG - Intergenic
1020653099 7:10898529-10898551 AATAACTAAAAGTGTATAATTGG + Intergenic
1020765633 7:12316688-12316710 AATAACTAAAAGAATATAATTGG + Intergenic
1020798492 7:12704599-12704621 AATAGCTAAAAGAGTATAATTGG - Intergenic
1021012949 7:15494003-15494025 AAGAACTAATAGAGTATAACTGG - Intronic
1021035459 7:15792977-15792999 AATAACAAAAAGAGTATAATTGG + Intergenic
1021093402 7:16508972-16508994 AATAACTAAAAGAGTATAATTGG + Intronic
1022070588 7:26909665-26909687 GAAAACTAAGAGTGTCTCAGAGG + Intronic
1022132542 7:27417476-27417498 AATAACTAAAAGAGTATAATTGG - Intergenic
1022227205 7:28375493-28375515 AATAACTAAAAGAGTATCATTGG + Intronic
1022749493 7:33208955-33208977 AATAACTAAAAGAGTCTAATTGG - Intronic
1022929935 7:35100692-35100714 AATAACTGAGAGAGTATAACTGG + Intergenic
1022972616 7:35531352-35531374 AATAACTAAAAGGGTATAATTGG + Intergenic
1023077035 7:36494591-36494613 AATAACTAGAAGAGTATAATTGG - Intergenic
1023189642 7:37566098-37566120 AATAACTAAAAGAGTATAATTGG - Intergenic
1023195061 7:37627931-37627953 AATAACTAAAAGAGCATAATTGG - Intergenic
1023214804 7:37849967-37849989 AATAACTAAAAGAGTATAATTGG + Intronic
1023265281 7:38398675-38398697 AATAACTAAAAGAATATTACTGG + Intronic
1023571719 7:41579265-41579287 AATAACTACATGAGTAGCAGTGG - Intergenic
1023622013 7:42083049-42083071 AATAATGAAGAGAGTATAATTGG - Intronic
1023713063 7:43015017-43015039 AATAAATAAGAAAGTATAAAAGG - Intergenic
1024132654 7:46371158-46371180 AAAAACTAACAGAGTATAAGTGG - Intergenic
1024454491 7:49587843-49587865 AATAACTACAAGAGTATAATTGG + Intergenic
1024689354 7:51782343-51782365 AATAACTAAAAGGGTATAATTGG + Intergenic
1024875001 7:54011707-54011729 AATAACTAAAAGAGTATAATTGG + Intergenic
1024957508 7:54939593-54939615 AATAACTCAAAGAGTATAATTGG + Intergenic
1024961758 7:54983986-54984008 AATGACTAAAAGAGTATAATTGG - Intergenic
1025061866 7:55816334-55816356 AATAACTAAAAGAGTATAGTTGG + Intronic
1025603270 7:63019253-63019275 AATAACTAAAAGAGTATAAGTGG - Intergenic
1025617613 7:63136379-63136401 AATAACTAAAAGAGTATACTTGG + Intergenic
1025861208 7:65330934-65330956 AATAACTAAAAAAGTATAATTGG - Intergenic
1026083073 7:67239681-67239703 AATAACTAAAAGAGTATAATTGG - Intergenic
1026116754 7:67502309-67502331 ACACACTAAGAGAGTATGAGAGG + Intergenic
1026136340 7:67664760-67664782 AATAACTAAAAGGGTATGATTGG - Intergenic
1026257860 7:68728125-68728147 AATAACTAAAAGAGTATAATTGG + Intergenic
1026379035 7:69780854-69780876 AATAACGGAGAGTCTATCAGAGG - Intronic
1026499291 7:70929458-70929480 AATAACTAAAAGAGTATAATTGG - Intergenic
1026510585 7:71024138-71024160 ACTAACTAAAAGAGTATAATTGG - Intergenic
1026530988 7:71197122-71197144 AATAACTAAAAGAGTATGACTGG - Intronic
1026693986 7:72574319-72574341 AATAACTAAAAGAGTATAATTGG + Intronic
1026737292 7:72957127-72957149 AAAAAATAAGAGAGAAGCAGAGG + Intergenic
1027106440 7:75407941-75407963 AAAAAATAAGAGAGAAGCAGAGG - Intronic
1027367817 7:77476784-77476806 AATAACTAAAAGAGTGTAATAGG - Intergenic
1027607094 7:80314106-80314128 AATAACCAAGAGAGAATCCCAGG + Intergenic
1027675274 7:81149750-81149772 AATAACTATAAGAGTATGATTGG + Intergenic
1027918083 7:84352365-84352387 AATAACAAAAAGAGTATAATTGG + Intronic
1027986628 7:85300028-85300050 AATAACTTAAAGAGTATAATTGG + Intergenic
1028001690 7:85505947-85505969 AATAATTAAAAGAGTATAATTGG + Intergenic
1028036420 7:85989774-85989796 AATAGCTAAAAGAGTATAATTGG - Intergenic
1028169317 7:87576917-87576939 AATAACTAAAAGGGTATAACTGG - Intronic
1028225667 7:88249870-88249892 AATAACTAAAATAGTATAATTGG - Intergenic
1028265997 7:88726398-88726420 AATAACTAAAAGAGTATAATTGG - Intergenic
1028352931 7:89871334-89871356 AATAAGTAAAAGAGTATAATTGG - Intergenic
1028503341 7:91543477-91543499 AATAACTAAAAGAGTATAATTGG + Intergenic
1028595868 7:92545924-92545946 AAGAACTAAAAGAGTATAATTGG + Intergenic
1028867916 7:95735252-95735274 AATAACTAAAAGAGTATAACTGG - Intergenic
1028950200 7:96626021-96626043 AATAACTGAAAGAGTATAATTGG - Intronic
1029088375 7:98029097-98029119 AATAACTAAAAGAGTATAACTGG - Intergenic
1029088984 7:98033345-98033367 AATAACTAAAAGAGTATAACTGG - Intergenic
1029112602 7:98221323-98221345 AATAACTAAAAGAGTAGAATTGG + Intronic
1029234924 7:99107257-99107279 AATAACTTAAAGAATATAAGTGG + Intronic
1029643388 7:101835711-101835733 AATAACTAAAAGTGTATAATTGG - Intronic
1029825828 7:103193136-103193158 AATAACTGAGAGAGTATAACTGG + Intergenic
1030041966 7:105459751-105459773 AATAACTAATAGAATATAATTGG - Intronic
1030154936 7:106445293-106445315 AATAACTAAAAGAGTATAATTGG - Intergenic
1030328785 7:108250740-108250762 AATAACTAAAAGAGTATAATTGG + Intronic
1030369112 7:108676923-108676945 AATAACAAAAAGAGTATAATTGG - Intergenic
1030465846 7:109902363-109902385 AACAACTAAAAGAGTATAATGGG - Intergenic
1030488212 7:110198558-110198580 AATAACTAAAATAGTATAATTGG - Intergenic
1030511868 7:110492694-110492716 AATAACTAAAAGAGTATAATTGG + Intergenic
1030569630 7:111206653-111206675 AATAACTGAAAGAGTATAATTGG - Intronic
1030679455 7:112419502-112419524 AATAACTAAAAGAGTATAATTGG + Intergenic
1030844800 7:114396016-114396038 AATAACTAAAAGAATATAATTGG - Intronic
1030880781 7:114876359-114876381 AATAACTGAAAGAGTATAATTGG - Intergenic
1031061704 7:117059175-117059197 AATAACTAAAAGAGTGTAATTGG + Intronic
1031243534 7:119276652-119276674 AATAACTAGAAGAGTATAATTGG - Intergenic
1031260476 7:119512365-119512387 AATAACAAACAGAGTATAATTGG + Intergenic
1031324655 7:120379220-120379242 AATAACCAAAATATTATCAGTGG - Intronic
1031460983 7:122048475-122048497 AATAACTAAAAGCATATCATTGG + Intronic
1031472797 7:122187281-122187303 AATAACTAAAAGAATATAATTGG + Intergenic
1031475000 7:122210627-122210649 AATAACTTAAAGAGTATAATTGG + Intergenic
1031553015 7:123137921-123137943 AATAACTAAAAGAGTATAATTGG - Intronic
1031566500 7:123304350-123304372 AATAACTAAAAGAGTATAATTGG + Intergenic
1031708495 7:125013495-125013517 AATAACTAAAAGAGTATAATTGG + Intergenic
1031759034 7:125687251-125687273 AATAACTAAAAGAGTATAATTGG + Intergenic
1031814286 7:126413844-126413866 AATAACTAAAAAAGTATGACTGG + Intergenic
1032138100 7:129300145-129300167 AATAACTAAAAGAGTATAATAGG - Intronic
1032731678 7:134649131-134649153 AATAACTAAAAGAGTACAATTGG - Intronic
1032845311 7:135747136-135747158 AGTAACTAAAAGGGTATCACTGG + Intronic
1032940361 7:136781458-136781480 AATAACTAGAAGAGTATAATTGG + Intergenic
1033180831 7:139176187-139176209 AATAACTAGAAGAGTATAATTGG + Intronic
1034127146 7:148683682-148683704 AATAACTAAAAGAGTGTAATTGG + Intergenic
1034247164 7:149655094-149655116 AATAACTAGAAGAGTATAATAGG + Intergenic
1034453662 7:151151962-151151984 AAGGACATAGAGAGTATCAGAGG - Intronic
1034654082 7:152715072-152715094 AATAACTAAAAGAGTAAAATTGG - Intergenic
1034847555 7:154460855-154460877 AATAACTAAAAGAGTATAATTGG - Intronic
1034914887 7:155029275-155029297 AATAACTCAAAGAGTATTATTGG - Intergenic
1034975159 7:155444523-155444545 AATAACTAAAAGGGTATAATTGG + Intergenic
1035506591 8:141299-141321 AATAACTGAAAGAGTATAATTGG + Intergenic
1036412548 8:8515921-8515943 AATAACTAAAAGAGTAAAATTGG - Intergenic
1036781972 8:11655596-11655618 AATAACTAAAAGAGTATAATTGG + Intergenic
1036979343 8:13451375-13451397 AATAACTAAAAGAGTGTAATTGG - Intronic
1037186553 8:16071068-16071090 AATAATTAAGACAGTATTATAGG + Intergenic
1037208588 8:16356808-16356830 AATAACTAAAAGAGTATAATAGG - Intronic
1037255939 8:16953681-16953703 AATAACTAAAAGAATATAATTGG + Intergenic
1037296103 8:17402246-17402268 AGTAACTAAAAGAGTATAACTGG - Intronic
1037353670 8:17994044-17994066 AATAACTAAAAGAGTATAACTGG - Intronic
1038142758 8:24864484-24864506 AATAACTAAAAGAGTATAATTGG + Intergenic
1038573440 8:28683482-28683504 AATAACTAAAAGAGTATAATTGG - Intronic
1038648858 8:29384277-29384299 AATAACTAAAAGAGTATAATTGG - Intergenic
1039100152 8:33932542-33932564 AATAACTAAAAGAATATAATTGG - Intergenic
1039266942 8:35835547-35835569 AATAACTAAAAGAGTATAATTGG + Intergenic
1039647020 8:39297635-39297657 AATGACTAAAAGAGTATAATTGG - Intergenic
1039781377 8:40789543-40789565 AATAACTAGGAGAGTATAATTGG + Intronic
1040004962 8:42612245-42612267 AATAACTAAAAGAGTATAATTGG - Intergenic
1040004973 8:42612400-42612422 AATAACTAAGAGAGTATAATTGG - Intergenic
1040477481 8:47792590-47792612 AATAACTAAAAGAGTATAACTGG + Intronic
1040867298 8:52061201-52061223 AATAACTAAAAGAGTGTAATTGG - Intergenic
1041482683 8:58341004-58341026 AATAACTAATAAAGTATAATTGG - Intergenic
1041556610 8:59164334-59164356 AATAACTAAGAGGATATAATTGG - Intergenic
1041578779 8:59432485-59432507 AATAACTAAAAGAGTATAAATGG - Intergenic
1042065168 8:64866955-64866977 AATAACTAAAAGAGTATAATTGG + Intergenic
1042099539 8:65259940-65259962 AATAACTTAGAGAGTATAATTGG - Intergenic
1042165355 8:65940232-65940254 AATAACTAAAAGAGTGTAACTGG + Intergenic
1042308840 8:67359593-67359615 AATAACTAAAATAGTATAATTGG + Intergenic
1042637748 8:70896883-70896905 AATAACTAAAAGAGTATAATTGG - Intergenic
1042757073 8:72226646-72226668 AATAACTAAAGGAGTATAATGGG + Intergenic
1042866312 8:73359500-73359522 AAGAACTTAGAAAGTAGCAGCGG - Intergenic
1042940668 8:74104146-74104168 AATATCTAAGATAGTAACAATGG + Intergenic
1042954955 8:74239958-74239980 AATAACTAAAAGAGTATAATTGG - Intronic
1042980918 8:74527042-74527064 AATAACTATAAGAGTATAATTGG + Intergenic
1043145584 8:76649407-76649429 AATAACTAAAAGAGCATAATTGG + Intergenic
1043243444 8:77966804-77966826 AATAACTAAAAGAGTATAATTGG + Intergenic
1043311511 8:78865524-78865546 AATAACTAAAAAAGTATAATTGG - Intergenic
1043477252 8:80617296-80617318 AATAACTAAAAGAATATAATTGG - Intergenic
1043574318 8:81640076-81640098 AATAACTAAAAGTGTATGACTGG + Intergenic
1043642604 8:82474282-82474304 AATAACTAAAAGATTATAATTGG + Intergenic
1043722663 8:83565462-83565484 AATAACTAAAATAGTATAATTGG - Intergenic
1043792877 8:84495334-84495356 GATAACTAAAACAGTGTCAGAGG + Intronic
1043799056 8:84584105-84584127 AATAACTAAAAGGGTATAATTGG - Intronic
1043804333 8:84652394-84652416 AGTATCAAAGAGACTATCAGGGG - Intronic
1043987196 8:86707791-86707813 ATGAACTAGGAGAGTAGCAGTGG + Intronic
1044006827 8:86947769-86947791 AATAACTAAAAGAGTATAATTGG - Intronic
1044084515 8:87927251-87927273 AATAACTAAAAGAGTATAATTGG + Intergenic
1044403863 8:91803851-91803873 AATAACTAAAAGACTATAACTGG + Intergenic
1044727482 8:95205128-95205150 TATAACTAGGAGTTTATCAGAGG - Intergenic
1044878633 8:96699471-96699493 AATAACTAAAAGAGTATAATTGG + Intronic
1044947199 8:97400407-97400429 AATAACTAAAAGAGTATAATTGG - Intergenic
1044957556 8:97497111-97497133 AATAACTAAAATAGTATAATTGG + Intergenic
1045192587 8:99897376-99897398 TATCACTAATACAGTATCAGTGG + Intergenic
1045264490 8:100607641-100607663 AATAACTAAAAGAGTATAATTGG + Intronic
1045372589 8:101539503-101539525 AAGAACTAAGAAGGTAGCAGAGG - Intronic
1045573105 8:103390290-103390312 AATAACTAAAAGAGTATAATTGG + Intergenic
1045591160 8:103599898-103599920 AATAACTACAAGAGTATAATTGG - Intronic
1045621659 8:103985171-103985193 AATAACTAAAAGAGTATAATCGG + Intronic
1045632180 8:104137792-104137814 AATAACTAAAAGAGTATAACTGG - Intronic
1045727388 8:105190148-105190170 AATAACTAAAAGAGCATAATTGG - Intronic
1045731829 8:105251296-105251318 AATAACTAGAAGAGTATAATTGG - Intronic
1045801095 8:106102146-106102168 AATAACTAAAATAGTATAACTGG + Intergenic
1045981147 8:108189367-108189389 AATAACTAAATGAGTATAATTGG - Intergenic
1045995259 8:108354382-108354404 AATAACTAAAATAGTATAATTGG + Intronic
1046113666 8:109758629-109758651 AATAACTAAAAGAGTACAACTGG - Intergenic
1046133923 8:110002487-110002509 AATAACTAAAAGAATATAACTGG - Intergenic
1046156320 8:110294585-110294607 AATAACTAAAAGAGTATAATTGG - Intergenic
1046308821 8:112406014-112406036 AATAACTTAAAGAGTATAATTGG + Intronic
1046370202 8:113295184-113295206 AATAACTATAAGAGTATAATTGG - Intronic
1047584252 8:126252306-126252328 AATAACTAAAAGAATATCACTGG + Intergenic
1047934154 8:129760348-129760370 AAAAACTAAAAGAGTATAACTGG + Intronic
1048554983 8:135466970-135466992 AATAACTAAAAGAGTATAATTGG + Intronic
1048584872 8:135766023-135766045 AATAACTTGAAGAGTATAAGTGG + Intergenic
1048608349 8:135993996-135994018 AATAACTAAAAGAGTATAACTGG + Intergenic
1048647118 8:136434221-136434243 AATAACTAAAAGAGTATAATGGG + Intergenic
1049903858 9:197362-197384 AATAACTAAAAGAGTATAATTGG - Intergenic
1050137786 9:2485638-2485660 AATAACTTAAAGAGTATAATTGG + Intergenic
1050194482 9:3066556-3066578 AATAACTCAAAGAGTATAACTGG - Intergenic
1050340090 9:4628239-4628261 AATAACTAAAAGAATATAATTGG + Intronic
1050643731 9:7696055-7696077 AATAACTAAAAGAGTATAACTGG - Intergenic
1050679916 9:8098927-8098949 AATAATTAAAAGAGTATAAATGG - Intergenic
1050866432 9:10506459-10506481 AATAACTAAAATAGTATAATTGG + Intronic
1050974645 9:11922092-11922114 AATAACTAAAAGAATATAACTGG - Intergenic
1051038773 9:12780941-12780963 AATAACTAAAAGAGTATATTTGG - Intronic
1051080029 9:13283106-13283128 AATGACTAAGAGAGAATCCCAGG + Intergenic
1051091369 9:13413056-13413078 AATAACTAAAATGTTATCAGTGG - Intergenic
1051313207 9:15799621-15799643 AATAACTGAAAGAGTATAATTGG - Intronic
1051345696 9:16148853-16148875 AATAACTAAAAGAATATAACTGG - Intergenic
1051593557 9:18800649-18800671 AATAAAAAAGAAAGTATAAGTGG + Intronic
1051815805 9:21104034-21104056 AATAACTAAAATAGTATAATTGG + Intergenic
1051827997 9:21242643-21242665 AATAACTAAAAGAGTATAATTGG - Intergenic
1051840068 9:21385960-21385982 AATAACTAAAATAGTATAAATGG - Intergenic
1051914842 9:22196395-22196417 CATAGCTAAGAGAGTGTAAGTGG - Intergenic
1051945021 9:22558002-22558024 AATAAGTATGAGACTAACAGAGG - Intergenic
1052058352 9:23928202-23928224 AATAACTAAAGGAGTATAACTGG - Intergenic
1052646792 9:31246544-31246566 AATAACTAAAAGCGTATAATTGG - Intergenic
1052666888 9:31506964-31506986 AATAACTAAAAGACTATAATTGG - Intergenic
1053047039 9:34928293-34928315 AATAACTAAAAGAGTATAATTGG + Intergenic
1053089492 9:35261624-35261646 AATAACTAAAAGAGTATAACTGG - Intronic
1053100476 9:35367509-35367531 AATAACGAAAAGAGTGTAAGTGG - Intronic
1053184210 9:36001629-36001651 AATAATTAAAAGAGTATAATTGG + Intergenic
1053279370 9:36807647-36807669 AATAACTGAAAGAGTATAATTGG - Intergenic
1053309690 9:37009666-37009688 AATAACTAAAAGAGTGTAATTGG + Intronic
1053520432 9:38772182-38772204 AATAACTAAAAGAGTAGAATTGG - Intergenic
1053746864 9:41207661-41207683 AGTAACTAAAAGAGTATAATTGG - Intergenic
1053830420 9:42074009-42074031 AATAACTAAAAGTGTATAATTGG + Intronic
1054480420 9:65657698-65657720 AATAACTAAAAGAGTATAATTGG + Intergenic
1054600139 9:67113446-67113468 AATAACTAAAAGTGTATAATTGG - Intergenic
1054681480 9:68223620-68223642 AATAACTAAAAGAGTATAATTGG + Intergenic
1054717925 9:68575821-68575843 AATAACTGAGAGAGAATCATTGG - Intergenic
1054854161 9:69880144-69880166 AATAACTAAAAGAGTATAATTGG - Intronic
1054984993 9:71251716-71251738 AATAACTAAAAGGGTATAATTGG - Intronic
1055387655 9:75780642-75780664 AATAACTAAAATAGTATAATTGG + Intergenic
1055790541 9:79918670-79918692 AATAACTGAGAGAGTAGAATTGG - Intergenic
1056009594 9:82313246-82313268 AATAACTAAAAGTGTATAATTGG + Intergenic
1056148742 9:83763420-83763442 AATAACTAAAATAGTATCATTGG + Intronic
1056180540 9:84078331-84078353 AATAACGAAAAGAGTATAATTGG + Intergenic
1056183860 9:84112247-84112269 AATAACTAAAAGAGTATAACTGG - Intergenic
1056473639 9:86930630-86930652 AATAACTAAAAGAGTATAATTGG + Intergenic
1056562650 9:87745763-87745785 AATAACTAAAAGAATATAATTGG - Intergenic
1056950095 9:91034919-91034941 AATAAAAAAGAAAGTGTCAGAGG - Intergenic
1057236985 9:93369011-93369033 AATAACTAAAAGAGTATAACTGG - Intergenic
1057288553 9:93782425-93782447 AATAACTCAAAGAGTATAATCGG - Intergenic
1057613556 9:96567801-96567823 AATAACTAAAAGAGTACAACCGG + Intronic
1058005501 9:99909758-99909780 AATAACTAAAAGAGTATAACTGG + Intronic
1058017773 9:100055277-100055299 AATAACTAAAAGAGTAAAACTGG + Intronic
1058077964 9:100669699-100669721 GATAACTAAAAGAGTATAATTGG + Intergenic
1058085193 9:100740700-100740722 AGTAACTAAAAGAGTATAATTGG - Intergenic
1058187565 9:101873021-101873043 AATAACTAAAAGAGTGTAATTGG - Intergenic
1058218581 9:102266643-102266665 AATAACTAAAAGAGTATAATTGG - Intergenic
1058248370 9:102659620-102659642 AATAACTTAAAGAGTATAATTGG + Intergenic
1058439928 9:104997305-104997327 AATAACTAAGGTAGTATAATTGG + Intergenic
1058875932 9:109244825-109244847 AATAATTAAAAGAGTAACAGTGG - Intronic
1059075562 9:111189929-111189951 AATAACTGAAAGAGTATAATTGG + Intergenic
1059160424 9:112029456-112029478 AATAACTAAAAGAGTATAATTGG + Intergenic
1059500080 9:114744899-114744921 AATAACTAAAAGGGTATAATTGG - Intergenic
1059540551 9:115126083-115126105 AATAACTAAAAGAGTGTAATCGG + Intergenic
1059547012 9:115186865-115186887 AATAACTTAAAGAGTATAATTGG - Intronic
1059631253 9:116125210-116125232 AATAACTAAAAGAGTATAATTGG - Intergenic
1059889081 9:118780889-118780911 ACTAACTAAAAGAGTATAATTGG - Intergenic
1059900061 9:118914360-118914382 AATAACTAAAAGAGTAAAATTGG - Intergenic
1059975379 9:119710718-119710740 AGTAACTAAAAGAGTATAACTGG + Intergenic
1060082239 9:120660405-120660427 AATAACTAAAGGAGTATAATTGG - Intronic
1060122906 9:121012098-121012120 AATAACTAAAAGAGTATAATTGG + Intronic
1060658766 9:125390438-125390460 AATAACTAAAGGAGTATAATTGG - Intergenic
1061638821 9:131935208-131935230 AATAACTAAAAGAGTATAATTGG + Intronic
1061827206 9:133266259-133266281 AATAACTAAAAGAGTATAGTTGG + Intronic
1202782995 9_KI270718v1_random:18441-18463 AATAACTAAAAGAGTATAATTGG - Intergenic
1203601717 Un_KI270748v1:16031-16053 AATAACTGAAAGAGTATAATTGG - Intergenic
1185838742 X:3369164-3369186 AATAACTAAAAGAGTATAATTGG - Intergenic
1185985178 X:4824777-4824799 AATAGCTAAAAGACTATCATTGG - Intergenic
1186122413 X:6378045-6378067 AATAACTAAAAGAGTATCGTTGG + Intergenic
1186226918 X:7409157-7409179 AATAACTAAAAGGGTATAACTGG - Intergenic
1186329392 X:8516060-8516082 AATAACTAAAAGAGTATAATTGG + Intergenic
1186426979 X:9470247-9470269 AATAACTAAAAGAGTATAATTGG - Intronic
1186601610 X:11043783-11043805 AATAACTAAAATAGTATAATTGG - Intergenic
1186710094 X:12184979-12185001 AATAACTAAAAGAGTAAAATTGG + Intronic
1186761822 X:12731085-12731107 AATAACTAAAAGAGTATAATTGG + Intergenic
1186842931 X:13503290-13503312 AATAACTCAAAGAGTATAACTGG - Intergenic
1186911117 X:14167477-14167499 AATAACTAAAAGATTATAATTGG - Intergenic
1186915722 X:14218126-14218148 AATAACTAAAAGAGTGTAACTGG - Intergenic
1187095692 X:16145635-16145657 AATAACTAAAAGAGTATAATTGG + Intronic
1187110541 X:16294513-16294535 AATAACTAAAAGAGTATAATTGG - Intergenic
1187120296 X:16399216-16399238 AATAACTAAAAGAGTGTAATTGG - Intergenic
1187346630 X:18471335-18471357 AATAACTAAAAGAGTATAACTGG - Intronic
1187554925 X:20342537-20342559 AATAACTAAAAGAGTATAATTGG - Intergenic
1187581860 X:20615730-20615752 AATAATTAAAAGAGTATAATTGG + Intergenic
1187637103 X:21241254-21241276 AATAACTAAAAGAGTATCATTGG + Intergenic
1187841179 X:23490198-23490220 AATAACTAAAAGAGTGTAATTGG + Intergenic
1187846821 X:23547301-23547323 AATAACTAAAAGAGTATAACTGG + Intergenic
1187859167 X:23665359-23665381 AATAACTAAAAGAGTATAATTGG + Intronic
1188077708 X:25799022-25799044 AATAACTAAAAGAGAATAATCGG - Intergenic
1188094696 X:26006686-26006708 AATAACTTAAAGAGTATAATTGG + Intergenic
1188112568 X:26209323-26209345 AAAAACTAAAAGAGTATAATTGG - Intergenic
1188265509 X:28068416-28068438 AATAATTAAAAGAGTATAATTGG - Intergenic
1188349060 X:29104606-29104628 AATAACTAAAAGAATATAATTGG + Intronic
1188536014 X:31197408-31197430 AATAACTAAAAGAGTAGAATTGG + Intronic
1188678281 X:32970301-32970323 AATAACTAAAAGAGTGTAATTGG + Intronic
1188720052 X:33511114-33511136 AATAACTAAAAGAGAATAATTGG - Intergenic
1188737044 X:33729778-33729800 AATAACTTAAAGAGTATAATTGG - Intergenic
1188739383 X:33759334-33759356 AGTAACTAAAAGAGTATTATTGG - Intergenic
1188753149 X:33928032-33928054 AATAATTCAGAGAGTATAATTGG + Intergenic
1188794615 X:34446467-34446489 AATAACTAAAATAGTATAATTGG - Intergenic
1188839151 X:34993543-34993565 AATAACTAAAAGAGTGTAATTGG + Intergenic
1188998630 X:36917731-36917753 AATGACTAAAAGTGTATAAGTGG - Intergenic
1189001089 X:36947810-36947832 AATAACTAAAAGAGTGTAATTGG - Intergenic
1189018595 X:37310356-37310378 AATAACTAAAAGGGTATAATTGG - Intergenic
1189020105 X:37326851-37326873 AATGACTAAAAGAGTATAATTGG + Intergenic
1189033727 X:37475211-37475233 AATAACTAAAAGAGTATAATTGG + Intronic
1189088836 X:38055968-38055990 AATAACTAAAAGAGTATAGGTGG - Intronic
1189113233 X:38315682-38315704 AATAACTAAGACAGTATCATTGG + Intronic
1189451284 X:41133502-41133524 AATAACTAAGAGAGTAAAACTGG - Intronic
1189532186 X:41896795-41896817 AATAACTAGAAGAGTATAATTGG - Intronic
1189572463 X:42312917-42312939 AATAACTAAAAGAGTATAATTGG - Intergenic
1189577559 X:42370834-42370856 AATAACTAAAAGAGTATAGTTGG - Intergenic
1189675858 X:43459823-43459845 AATAACTAAGAAAGTATACTTGG + Intergenic
1189711009 X:43811843-43811865 AACAACTAAGAGGGTATAATTGG - Intronic
1189864977 X:45318419-45318441 AATAACTAAAAGAGTATAATTGG + Intergenic
1189870538 X:45378172-45378194 AATAACTAAAAGAGTATAATTGG + Intergenic
1189880870 X:45490950-45490972 AATAACTAAAAGAGTTTAATTGG - Intergenic
1189887830 X:45567039-45567061 AATAACTAAAAGAGTATAATTGG + Intergenic
1189895924 X:45656737-45656759 AATAACTAAAAGAGTATGACTGG - Intergenic
1189913617 X:45835801-45835823 AATAGCTAAAAGAGTATAATTGG + Intergenic
1189935617 X:46065538-46065560 AATAACTAAAAGAGTATAATTGG - Intergenic
1190038227 X:47046883-47046905 AATAACTAAAAGGGTATAATTGG + Intronic
1190171987 X:48118870-48118892 AATAACTAAAAGAGTGTAAATGG + Intergenic
1190373840 X:49769270-49769292 AATATCTAAAAGAGTATAACTGG - Intergenic
1190392972 X:49950885-49950907 AAGAACTAAAAGAGTATAATTGG - Intronic
1190464488 X:50712420-50712442 AATAACTAAAAGAGTGTAACTGG + Intronic
1190479339 X:50860327-50860349 GATAACTAAAAGAGTATAATGGG - Intergenic
1190522809 X:51297558-51297580 AATAACTAAAAGAGTATTATTGG + Intergenic
1190523492 X:51304521-51304543 AATAACTAAAAGAGTATAATTGG + Intergenic
1190532336 X:51392184-51392206 AATAACTAAAAGAGTATAATAGG + Intergenic
1190601803 X:52100545-52100567 AATAACTAAAAGAGTATAATTGG - Intergenic
1190615858 X:52230260-52230282 AATAACTAAAAGAGTGTAACTGG + Intergenic
1190658283 X:52632132-52632154 AATAACTAAAAGAGTGTAATTGG + Intergenic
1190798392 X:53765725-53765747 AATAACTAAAAGAGTGTAATTGG - Intergenic
1190799904 X:53778145-53778167 AATAACTAAAAGAGTGTAATTGG - Intergenic
1190918882 X:54831194-54831216 AATAAGTAAAAGAGTATAAATGG - Intergenic
1190926063 X:54905878-54905900 AATAACTAAAATAGTATAATTGG + Intergenic
1190961180 X:55249817-55249839 AATAACTAAAAGAGCATAACTGG + Intronic
1190992002 X:55561425-55561447 AATAACCAAGACAGGATCATTGG - Intergenic
1191017346 X:55823723-55823745 AATAACTAAAAGAGTATAACTGG - Intergenic
1191027159 X:55926011-55926033 AATAACTAAAGGAGTATAATTGG - Intergenic
1191040626 X:56075521-56075543 AATAACTAAAAGAGTGTAATTGG - Intergenic
1191051875 X:56202432-56202454 AATAACTAAAAGAGTGTAATTGG - Intergenic
1191081467 X:56514780-56514802 AATAATTAAAAGAGTATAATTGG + Intergenic
1191199069 X:57758965-57758987 AATTACTAAAAGAGTATAATTGG + Intergenic
1191655622 X:63595649-63595671 AATAGCTAAAAGAGTATAATTGG - Intergenic
1191701398 X:64046485-64046507 AATAACTAAAAGAGTATAATTGG + Intergenic
1191766024 X:64699044-64699066 AATAACTAAAAGAGTATAGTTGG - Intergenic
1191833174 X:65436843-65436865 AATAACTGAAAGAGTATAATTGG - Intronic
1191957637 X:66662522-66662544 AATAACTTAAAGAGTATAATTGG + Intergenic
1191990918 X:67036038-67036060 AATAACTAAGAGAGTATAATTGG - Intergenic
1192041378 X:67626077-67626099 AATAACTAAAAGAGTATAATTGG - Intronic
1192045339 X:67666070-67666092 AATAACTAAAAGAATATAATTGG - Intronic
1192070090 X:67929540-67929562 AATAACTAAAAGAGGATAATTGG + Intergenic
1192070448 X:67934523-67934545 AATAACTAAAAGACTATAATTGG + Intergenic
1192105650 X:68313830-68313852 AATAACTAAAAGAGTATAATTGG + Intronic
1192137656 X:68619436-68619458 AATAACTAAAAGAGTATACTTGG - Intergenic
1192154013 X:68729993-68730015 AATAGCTAAAAGAGTATAATTGG + Intergenic
1192227625 X:69240154-69240176 AATAACTGAAAGAGTATAACTGG - Intergenic
1192308451 X:69988385-69988407 AATAACCAAAAGAGTATAAGTGG + Intronic
1192377672 X:70580428-70580450 AATAACTAAAAGAGTATAATTGG + Intronic
1192394740 X:70768119-70768141 AATAACTAAAATAGTATAATTGG + Intronic
1192417099 X:70991202-70991224 AGTAACTAAAAGAGTATAATTGG - Intergenic
1192493885 X:71600831-71600853 AATAATTAAAAGAGTATAACTGG - Intronic
1192680683 X:73250675-73250697 AATAACTAAAATAGTATAATTGG + Intergenic
1192721902 X:73707908-73707930 AATAACTAAAAGAGTATAACTGG + Intergenic
1192834917 X:74788940-74788962 AATAAATAAAAGAATATCAATGG - Intronic
1192886553 X:75341398-75341420 AATATCTAAAAGAGTATAATTGG - Intergenic
1192960001 X:76119234-76119256 AATAACTGAAAGAGTATAATTGG + Intergenic
1193093446 X:77520291-77520313 AATAACTAGAAGAGTATAACTGG + Intronic
1193122312 X:77836371-77836393 AATAACTAAAAAAGTATAATTGG + Intronic
1193139178 X:78007934-78007956 AATAACTAAAAGAGTATAAATGG - Intronic
1193166645 X:78288715-78288737 AATAACTAAAAGAGTAAAATTGG - Intronic
1193194396 X:78613370-78613392 AATAACTAGAAGAGTATAATTGG - Intergenic
1193211943 X:78817055-78817077 AATAACTAAAAGTGTATAATTGG + Intergenic
1193245686 X:79225995-79226017 AATAACTAAGAGAGTATAACTGG - Intergenic
1193253559 X:79320558-79320580 AATAACTAAAAGAGTAAAATTGG + Intergenic
1193321172 X:80123206-80123228 AATAACTAAAAAAGTATAATTGG - Intergenic
1193342599 X:80367977-80367999 AATAACTAAAAGAGTATAATTGG + Intronic
1193361093 X:80579481-80579503 AATAACTAAAAGAGTATAATTGG - Intergenic
1193439292 X:81518641-81518663 AATAACTAAAAGGGTATAATTGG + Intergenic
1193529219 X:82635248-82635270 AATAACTAAAGGAGTATAATTGG - Intergenic
1193593216 X:83415387-83415409 AATAACTAAAAGAGCATAATTGG + Intergenic
1193670752 X:84382834-84382856 AATAACTAAAAGAGTGTAATTGG + Intronic
1193742811 X:85238699-85238721 AATAACTAAAAGAATATAATTGG + Intergenic
1193754897 X:85396776-85396798 AATAACTAAAAGAGTGTAATTGG - Intergenic
1193759949 X:85452532-85452554 AATAACCAAGAAAGTAGAAGAGG - Intergenic
1193761569 X:85473304-85473326 AATAACTAAAAGAGTATAATTGG + Intergenic
1193796209 X:85877573-85877595 AATAACTAAAAGAGTATAACTGG + Intronic
1193822054 X:86177130-86177152 ATTAACTAAGAAAGTATAATCGG - Intronic
1193867860 X:86758919-86758941 AATAACTAAAAGAATATGAGTGG - Intronic
1193879751 X:86907646-86907668 AATAACTAAAAGAGCATAATTGG + Intergenic
1193887560 X:87001770-87001792 AATAACTTAAAGAGTATAATTGG - Intergenic
1193898115 X:87139733-87139755 AATAACTAAAGGAGTATCATGGG + Intergenic
1193943090 X:87700729-87700751 AATAACTGAAAGAGTATAACTGG - Intergenic
1193989909 X:88293884-88293906 AAAAACTAAAAGAGTATAATGGG + Intergenic
1194024232 X:88731630-88731652 AATAACTAAAAGAGTGTAATTGG + Intergenic
1194047004 X:89020287-89020309 AATAACTAAAAGAGTGTAAGTGG + Intergenic
1194087538 X:89547239-89547261 AATAACTAAAAAAGTATAATTGG - Intergenic
1194139079 X:90186333-90186355 AATAACTAAAAGAGTGTAATTGG + Intergenic
1194162868 X:90476621-90476643 AATAACTAAAATAGTATAATTGG + Intergenic
1194249673 X:91559595-91559617 AATAACTAAAAGAGTATAATTGG + Intergenic
1194251964 X:91587127-91587149 AATAACTAAAATAGTATAATTGG + Intergenic
1194312515 X:92329963-92329985 AATAACTAAAAGAGTATAATTGG + Intronic
1194499905 X:94669418-94669440 AATAACTAAGAGAGTCTAATTGG - Intergenic
1194531166 X:95050979-95051001 AATAACTAAAAGAATATAATTGG + Intergenic
1194774810 X:97949214-97949236 AATAACTAAAAGAGTATAACTGG + Intergenic
1194824018 X:98539787-98539809 AATAACTTAAAGAGTATAATTGG + Intergenic
1194841163 X:98744729-98744751 AATAACTAAAAGAGTGTAATTGG - Intergenic
1194879215 X:99229349-99229371 AATAACTAGAAGAGTATTATTGG + Intergenic
1194903544 X:99544235-99544257 AATAACTAAAAGAGTATAACTGG - Intergenic
1194925862 X:99822253-99822275 GATAACTAAGAGAATATAATTGG + Intergenic
1195027485 X:100892296-100892318 AATAACTAAAAGAGTATAATGGG + Intergenic
1195074747 X:101315898-101315920 AATAACTGAAAGAGTATAATTGG - Intergenic
1195089789 X:101447843-101447865 AATAACTAAAAGAGTCTAACTGG - Intronic
1195223990 X:102773437-102773459 AACAACTAAAAGAGTATAATTGG - Intergenic
1195279745 X:103319906-103319928 AATAACTAAAAGAATATAATTGG - Intergenic
1195304324 X:103564436-103564458 AATAACTAAAAGAGTATAATTGG + Intergenic
1195312991 X:103652233-103652255 AATAACTAAAAGAGTATAATTGG + Intergenic
1195406547 X:104520682-104520704 AATAACTGAAAGAGTATAATTGG - Intergenic
1195502316 X:105615813-105615835 AATAACTAAAAGAGTATCGTTGG + Intronic
1195507765 X:105678353-105678375 AATAACTAAATGAGTATAACTGG - Intronic
1195547702 X:106131511-106131533 AATAAGTAAAAGAGTATAATTGG + Intergenic
1195585105 X:106556119-106556141 AATAACTAAAAGAGTACAATTGG + Intergenic
1195589377 X:106606339-106606361 AATAACTAAAAGAGCATAATTGG + Intergenic
1195686524 X:107591910-107591932 AATAACTAAAAGAGTATAATTGG - Intronic
1195730412 X:107960811-107960833 AATAACTAAAAGAGTATAATTGG - Intergenic
1195781915 X:108476420-108476442 AATAACTAAGAGAGTATAACTGG - Intronic
1195804767 X:108752111-108752133 AATAACTAAAAGAGTATAATTGG - Intergenic
1195851591 X:109288169-109288191 AATAACTAAAAGAGTGTAATTGG - Intergenic
1195856788 X:109340291-109340313 TATAACTAAAAGAGTATAATTGG + Intergenic
1195917602 X:109951192-109951214 AAGAACTAAAAGAGTATAATAGG + Intergenic
1196056393 X:111360579-111360601 AATAACTAAAAGAGTATAATTGG + Intronic
1196071463 X:111527828-111527850 AATAACTAAAAAAGTATAATTGG + Intergenic
1196141868 X:112271894-112271916 CATAACTAAAAGAGTATAATTGG - Intergenic
1196154568 X:112413829-112413851 AATAACTAAAAGAGTAGAATTGG + Intergenic
1196216206 X:113054761-113054783 AATAAATAAAAGAGTATAATTGG + Intergenic
1196267750 X:113671758-113671780 AATAACTAAAAGAATATAATTGG - Intergenic
1196305166 X:114093791-114093813 AACAACTAAAAGAGTATAATTGG + Intergenic
1196316131 X:114226201-114226223 AATAACTAAGAGAATATAATCGG + Intergenic
1196352282 X:114745945-114745967 AATAACTTAAAGAGTATAATTGG + Intronic
1196460877 X:115929053-115929075 AATAACTAAAAGGGTATAATTGG - Intergenic
1196479592 X:116131575-116131597 AATAACTAAAAGAGTACAATTGG - Intergenic
1196493847 X:116300432-116300454 AATAACTGAAAGAGTATAATTGG - Intergenic
1196574003 X:117297362-117297384 AATAACTCAAAGAGTATAATTGG - Intergenic
1196578639 X:117352605-117352627 AATAACTAATAGAGTGTAATTGG - Intergenic
1196605268 X:117650455-117650477 AATAACTAAAAGAGTATAATTGG + Intergenic
1196771162 X:119295333-119295355 AATAACTAAAAGAGAATAATTGG - Intergenic
1196882910 X:120215285-120215307 AATAACTAAAATAGTATAATTGG + Intergenic
1196981914 X:121223862-121223884 AATAACTATAAGAGTATAATTGG - Intergenic
1196986638 X:121281026-121281048 AATAACTAAAACAGTATAATTGG + Intergenic
1196996047 X:121385129-121385151 AATAACTAAAAGAGTGTCATTGG + Intergenic
1197019445 X:121668996-121669018 AATAACTAAAAGAATATAATTGG + Intergenic
1197101284 X:122658647-122658669 AATAACTAAAAGAGTATAATTGG + Intergenic
1197139858 X:123105583-123105605 AATAACTAAAAGAGTATAACTGG + Intergenic
1197165330 X:123370895-123370917 AATAACTAAAAGAGGATAATTGG - Intronic
1197178435 X:123509064-123509086 AATAACTAAAAGAGTATAATTGG + Intergenic
1197286289 X:124598889-124598911 AATAGCTAAAAGAGTATAATTGG + Intronic
1197325088 X:125082936-125082958 AATAACTACAAGAGTATAATTGG - Intergenic
1197357470 X:125453378-125453400 AATAACTACAAGAGTATAATTGG + Intergenic
1197435090 X:126418092-126418114 AATAACTAAATGAGTATAATTGG - Intergenic
1197452148 X:126632601-126632623 AATAACTAAAAGATTATAATTGG - Intergenic
1197484310 X:127028701-127028723 AATAACTAAAATAGTATAATTGG + Intergenic
1197508275 X:127336429-127336451 AATAACTAAAAGAGTATAATTGG - Intergenic
1197518352 X:127465300-127465322 AATAACTAAAAGAGTATAATTGG + Intergenic
1197519558 X:127480461-127480483 AATAACTAAAAGAGTATAATTGG - Intergenic
1197531482 X:127633228-127633250 AATAACTAAAAGAGTATAATTGG - Intergenic
1197559911 X:128007338-128007360 AATAACTAAAAGAGTATAATTGG - Intergenic
1197587032 X:128361247-128361269 AATAACTAGAAGAGTATAATTGG - Intergenic
1197621637 X:128757120-128757142 AATAACTAAAAGAGTATAATTGG - Intergenic
1197810355 X:130436324-130436346 AATAACTAAAAGAGTATAAATGG - Intergenic
1197897710 X:131333147-131333169 AATAACTAAAAGAGTGTAATTGG - Intronic
1197926458 X:131651821-131651843 AATAACTAAAAGAGTGTAATTGG - Intergenic
1197970884 X:132113787-132113809 AATAACTAAAAGAGTGTAATTGG - Intronic
1197999395 X:132416568-132416590 AATAACTAAAAGAGTAGGATTGG + Intronic
1198294235 X:135270233-135270255 AATAACTAAAATAGTATAACTGG + Intronic
1198316031 X:135467370-135467392 AATCACTAAAAGAGTATCATTGG + Intergenic
1198342761 X:135731292-135731314 AATCACTAAAAGAGTATAATTGG - Intergenic
1198345228 X:135752003-135752025 AATCACTAAAAGAGTATAATTGG + Intergenic
1198407656 X:136330835-136330857 AATAACTAAATGAGTATAATTGG - Intronic
1198430269 X:136558782-136558804 AATAACTAAAATAGTGTAAGAGG - Intergenic
1198612810 X:138420754-138420776 AATAACTGAAAGAGTATAATTGG + Intergenic
1198632823 X:138660615-138660637 AATAACTAAAAGAGTATAACTGG - Intronic
1198706687 X:139456812-139456834 AATAACTAATATAGTAACATTGG - Intergenic
1198717054 X:139568833-139568855 AATAACTAAAAGAGTATCATTGG + Intergenic
1198945260 X:142005073-142005095 AATAACTAAAAGAATATAATTGG - Intergenic
1198956944 X:142143259-142143281 AATAAGTAAAAGAGTATTACTGG + Intergenic
1199007278 X:142715825-142715847 AATAACTAAAAGAGTATAATTGG + Intergenic
1199018285 X:142846172-142846194 AATAACTAAAAGAGTATAATTGG - Intergenic
1199162189 X:144627093-144627115 AATAACTAAAAGAGTAGAATTGG - Intergenic
1199184822 X:144903678-144903700 AATAACTAAAAGAGTGTAACTGG + Intergenic
1199203334 X:145119339-145119361 AATAACTCAGAGAGTGTAATGGG + Intergenic
1199237555 X:145508527-145508549 AATAACTAAAAGAGTATAATTGG + Intergenic
1199316410 X:146383645-146383667 AATAACTAAAATAGTATAATTGG + Intergenic
1199325920 X:146498105-146498127 AATAACTAAAAGAGTATAATTGG + Intergenic
1199362216 X:146935054-146935076 AATAACTAAAAGAGTATAATTGG - Intergenic
1199367849 X:147008025-147008047 AATAACTAAAAGAGTATAATTGG - Intergenic
1199441525 X:147873897-147873919 AATAACTAATAGAGTGTAATTGG + Intergenic
1199442670 X:147886173-147886195 AATAACTAAAAGAGTACAATTGG - Intergenic
1199475020 X:148235570-148235592 AATAAGTAAAAGAGTATAACTGG + Intergenic
1199477682 X:148263644-148263666 AATAACAAAAAGAGTAGAAGAGG + Intergenic
1199580538 X:149355856-149355878 AATAACTAAAAGAGTATAACCGG - Intergenic
1199795758 X:151194272-151194294 AATAACTAAAAGAGTATAACTGG + Intergenic
1199892294 X:152097952-152097974 AATAACTAAAGGAGTATAATTGG + Intergenic
1200335223 X:155343603-155343625 AATAACTAAGAGAGTAGAACTGG - Intergenic
1200351245 X:155497618-155497640 AATAACTAAGAGAGTAGAACTGG + Intronic
1200364945 X:155652245-155652267 AATAACTAAAAGAGTGTAATTGG - Intronic
1200509143 Y:4054352-4054374 AATAACTAAAATAGTATAATTGG + Intergenic
1200570896 Y:4828365-4828387 AATAACTAAAATAGTATAATTGG + Intergenic
1200620780 Y:5444096-5444118 AATAACTAAAAGAGTATAATTGG + Intronic
1201068367 Y:10121298-10121320 AAAAACTAAAAGAGTATAATTGG + Intergenic
1201237043 Y:11921741-11921763 AATAACTAAAAGAGTATAATTGG + Intergenic
1201309640 Y:12584793-12584815 AATAACTTAAAGAGTATAATTGG + Intergenic
1201437397 Y:13974223-13974245 AATAACTTATAGAGTATAATTGG + Intergenic
1201760075 Y:17527299-17527321 AAAAACTAAAAGAGTATAACTGG - Intergenic
1201841479 Y:18378691-18378713 AAAAACTAAAAGAGTATAACTGG + Intergenic
1201925460 Y:19282002-19282024 AATAACAAAGAAAGTTTAAGGGG - Intergenic
1202012358 Y:20357554-20357576 AATAACTAAGGTAGTAACACAGG - Intergenic
1202429713 Y:24762574-24762596 ACTAACTAATAGAGTGTCTGAGG + Intergenic