ID: 999923642

View in Genome Browser
Species Human (GRCh38)
Location 5:156350907-156350929
Sequence ACAGCTAGTAAGTAAAACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999923641_999923642 12 Left 999923641 5:156350872-156350894 CCAAGGCTCAGAGAAGTTGAGTG 0: 3
1: 15
2: 60
3: 334
4: 1068
Right 999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG 0: 1
1: 0
2: 0
3: 8
4: 127
999923640_999923642 13 Left 999923640 5:156350871-156350893 CCCAAGGCTCAGAGAAGTTGAGT 0: 1
1: 2
2: 29
3: 138
4: 549
Right 999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG 0: 1
1: 0
2: 0
3: 8
4: 127
999923639_999923642 23 Left 999923639 5:156350861-156350883 CCACTGAAAACCCAAGGCTCAGA 0: 1
1: 1
2: 2
3: 28
4: 271
Right 999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG 0: 1
1: 0
2: 0
3: 8
4: 127
999923638_999923642 24 Left 999923638 5:156350860-156350882 CCCACTGAAAACCCAAGGCTCAG 0: 1
1: 0
2: 1
3: 11
4: 179
Right 999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG 0: 1
1: 0
2: 0
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999923642 Original CRISPR ACAGCTAGTAAGTAAAACGC TGG Intronic
903807272 1:26014326-26014348 ACAGCCAGTGAGTAACAGGCTGG - Intergenic
904252299 1:29233843-29233865 ACAGCTAGTAAATAGACGGCGGG - Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
908824061 1:68116491-68116513 ACAGCTAGGAAGTAACAGCCTGG - Intronic
909111834 1:71488931-71488953 ACAGATAGTAAGTAAAATAGTGG - Intronic
910532689 1:88258130-88258152 ACAGCTAGTAAGAAGGAAGCAGG + Intergenic
913335688 1:117707398-117707420 CCAGCTAATAAGTACAACACAGG - Intergenic
915356818 1:155260314-155260336 ACAGCTAGTAAGTAATAGAGTGG - Exonic
916014822 1:160740583-160740605 ACAGCTACTAAGTCAAACCAAGG - Intronic
916057361 1:161077108-161077130 ACAGCTGGTAAGTAGAACTAGGG + Intronic
917802855 1:178585982-178586004 ATAGTTAGTAAGTACAAAGCTGG - Intergenic
918210809 1:182349392-182349414 ACACCAAGTAAGTAATAGGCAGG - Intergenic
920196356 1:204229861-204229883 ACAGCTATTAAGTACAGAGCTGG - Intronic
920371143 1:205480157-205480179 ACAGCTAGAAAGTAACAGGTAGG + Intergenic
922041171 1:221900254-221900276 ACAGCTAGTAAGCAAAGTGGGGG - Intergenic
922583779 1:226718702-226718724 TTAGCTACTAAATAAAACGCTGG + Intronic
923295166 1:232587605-232587627 ACAGCTAGTAAGTACAGTGTGGG - Intergenic
1062856532 10:782510-782532 ACAGACAGAAAGTAAAACGGTGG + Intergenic
1063161586 10:3422525-3422547 ACAGCAAGGAAGGCAAACGCAGG - Intergenic
1063213841 10:3906165-3906187 ACAGCTAGTTAGTGACACGAGGG + Intergenic
1064863261 10:19850633-19850655 ACAGATAGTAATTTAAATGCAGG - Intronic
1069353151 10:67553548-67553570 GCTGCTAATAAGTAAAATGCAGG - Intronic
1070259142 10:74836920-74836942 ACTGTTAGCAAGTAAAACTCAGG + Intronic
1072170896 10:92860644-92860666 AGAGATAGAAAGTAAAATGCTGG - Intronic
1075910336 10:126119259-126119281 ATAACTAGTAAGTAAAAAACTGG - Intronic
1076583504 10:131530519-131530541 ACAGCTAATAGGAAAAACGCAGG - Intergenic
1077736028 11:4791998-4792020 ACAGCTAGTAGGTAAAATCCAGG - Intronic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1080336907 11:31208112-31208134 ATAGATAGTAAGTAAAACCATGG - Intronic
1081049993 11:38326967-38326989 ACAACTAGTAAGTCGAAGGCCGG - Intergenic
1081113793 11:39172306-39172328 ACAGCTGGTAAGTAAAGGGTTGG + Intergenic
1081531970 11:43968108-43968130 GCATCTAGTAAGTAGAACCCGGG + Intergenic
1083007975 11:59366887-59366909 ACAGCTAGTAAGTGAAGGGGTGG + Intergenic
1083869880 11:65480240-65480262 ACAGCTAGTAAAAATAAGGCAGG - Intergenic
1084782295 11:71418260-71418282 AGAGCCACTCAGTAAAACGCTGG + Intergenic
1085704476 11:78774030-78774052 ACAGGTAGTAAGTAAAATGATGG - Intronic
1086316458 11:85599509-85599531 ACAGCTAGTAAGTAAGATCTGGG - Intronic
1087292576 11:96336133-96336155 ACAGCTAGTAAGTATAACATAGG + Intronic
1087312659 11:96567885-96567907 TCATCTAGTAAATAAAACACAGG - Intergenic
1087902030 11:103651661-103651683 ACAGCTAGAAAGTTGAAGGCTGG - Intergenic
1090766232 11:129878600-129878622 ACAGCTAGTAAAGAGAAAGCAGG - Intronic
1092970976 12:13694548-13694570 ACAGCTAGTAAGTGACAGACTGG + Intronic
1097710521 12:62912658-62912680 AAAGCTAATAAGACAAACGCAGG + Intronic
1098378671 12:69844632-69844654 ACAGCTTGTAAGTGACACACAGG - Intronic
1098568421 12:71961183-71961205 ACAGCTAGTAAGTACAATAGTGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1101791559 12:107932404-107932426 TCAGCTAGTAGGTAAGAGGCAGG - Intergenic
1105576657 13:21659558-21659580 ACAGCTAGGAAGTAATGGGCAGG - Intergenic
1105903301 13:24777506-24777528 ACAGATAATAAATAAAACTCTGG + Intronic
1107256634 13:38435406-38435428 GCAGCTAGGCAGCAAAACGCAGG - Intergenic
1109037390 13:57283274-57283296 ACAGCTAGTAAGTTACACAACGG + Intergenic
1118081849 14:62370135-62370157 ACAGCTACTCAGTAGAACCCAGG + Intergenic
1118117260 14:62794461-62794483 ACAGCTAGTAAGTAATTGGTGGG - Intronic
1120671728 14:87369978-87370000 ACAGGTAGTCAGTTAACCGCTGG + Intergenic
1126299576 15:47181197-47181219 ACTGCTAGTAAGTAAGAAGGAGG - Intergenic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1131385454 15:92002891-92002913 ACAGCTATTAAGTAGAACTGGGG - Intronic
1133046425 16:3090751-3090773 AAAGCTGGTAGGTAAAAGGCCGG + Intronic
1135732197 16:24904325-24904347 ACAGCTAGTATGGAAAACTATGG - Intronic
1135922864 16:26666862-26666884 ACAGCTAGTAAGGAGAAGGGTGG - Intergenic
1138920274 16:61519342-61519364 ACAGCTTCTAAAGAAAACGCTGG - Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1142584603 17:963774-963796 ACAGTTAATAAATAAAATGCTGG + Intronic
1142786645 17:2229482-2229504 ACAGCTAGTAAATTATACACAGG - Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1150125137 17:62630378-62630400 ACCCCTAGTAAGTGAAAGGCTGG + Intronic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1160966564 19:1749353-1749375 CCATCTAGAAAGTAACACGCTGG - Intergenic
1167660336 19:50792389-50792411 ACAGCTAGTGAGTAGCAAGCTGG - Intronic
926454260 2:13044739-13044761 ACAGCTAATAAGTGAAGCGAAGG + Intergenic
927588070 2:24328086-24328108 AGAGCTAGCAAGGAAAACTCAGG - Exonic
932742964 2:74306028-74306050 AGAGATAGTAAGTAAAAAGGGGG - Intronic
933415382 2:81981066-81981088 ACAGCTAGTAAGTAGTACATCGG + Intergenic
933707306 2:85301565-85301587 AAAGCTATTGAGAAAAACGCTGG - Intronic
939369595 2:141281823-141281845 ATAGCTAGTAAGTAGAAGACTGG - Intronic
939658212 2:144853714-144853736 ACACATACTAAGTAAAACCCTGG - Intergenic
940497305 2:154448474-154448496 ACAGCCAGTAAGTAAAGGACAGG + Intronic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
946596485 2:221311021-221311043 ACAGCCAGGAAGTAAAAGTCAGG + Intergenic
947049512 2:226026564-226026586 ACAGCAGGTAAGTAAAATGGAGG + Intergenic
1169754481 20:9029068-9029090 ACAGCAAGTAAATCAAATGCCGG + Intergenic
1170207958 20:13819775-13819797 ACAGCAAGTAAGAAAAGTGCTGG - Exonic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1181969939 22:26682238-26682260 AAAGCTAGTTCATAAAACGCGGG + Intergenic
1183268407 22:36845393-36845415 TCAGCTGGTAAGTAGGACGCTGG + Intergenic
1184911704 22:47539753-47539775 ACAGCTGGGGAGTAAAATGCTGG + Intergenic
949194317 3:1287291-1287313 GCATCTAGTAAGTAAAAGCCAGG - Intronic
951279972 3:20736192-20736214 ACAGGTAGTAAGCTAAAGGCTGG + Intergenic
955639974 3:61072079-61072101 AGAGCTAGAAAGTAAAGAGCTGG - Intronic
961255667 3:125549329-125549351 ACAGAAAGTAAGTAAAAGTCAGG - Intronic
961945266 3:130680283-130680305 ACAGCTAGTAAACAGAAAGCTGG - Intronic
964187277 3:153961726-153961748 ACAGCCAGTTAGGAAAAGGCAGG - Intergenic
969555835 4:7909303-7909325 ACAGCTAGTTAGCAAAACCCAGG + Intronic
970796028 4:19914481-19914503 ACAGCTGGTAAGGCAAATGCAGG + Intergenic
976663040 4:87560248-87560270 ACAGCAAGTATCTAAAACTCTGG - Intergenic
977914778 4:102579094-102579116 TCAGCTAGCAAGTAAATGGCAGG - Intronic
978780312 4:112545916-112545938 AGAGCTAGAAAGTAGAACACAGG + Intronic
979551961 4:122001595-122001617 ACAGATAAAAAGCAAAACGCTGG - Intergenic
981357085 4:143801799-143801821 ACAGCCAGTAGGTAAAACTGAGG - Intergenic
986234046 5:5891384-5891406 TCAGCTAGTCAGTGAAATGCTGG - Intergenic
991405263 5:66295032-66295054 AAAGCTAGAAAATAAAATGCAGG + Intergenic
992848362 5:80778034-80778056 ATAGCTAGTAAGTAAGTGGCAGG + Intronic
997159193 5:131589096-131589118 ACAGCAACTAAGAAAAAGGCAGG + Intronic
998050913 5:139034135-139034157 ACAGATATTAATTAAAAAGCAGG - Intronic
999683076 5:154077776-154077798 TCAGCTAGTAAGAAACAGGCTGG - Intronic
999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG + Intronic
1001057041 5:168458290-168458312 ACAGCTGCTAAGTACAAAGCTGG + Intronic
1011063589 6:83299314-83299336 ACAGCTAGCAAGGAAAGCGAAGG - Intronic
1014763318 6:125382159-125382181 GCAGCTAGTAAGTAAAAAACTGG - Intergenic
1018361906 6:163079020-163079042 ACAGCTAGTTAGTAGCAAGCTGG - Intronic
1021935563 7:25627719-25627741 ACAGCTAGTAATTGAAAACCAGG + Intergenic
1022983628 7:35628121-35628143 ACAGCTAGTAAGTAACACAATGG - Intergenic
1027459268 7:78432424-78432446 ACATCTAGTCAGTGAAACCCAGG + Intronic
1030160497 7:106503542-106503564 AAAACCAGTAAGTAAAACGTTGG + Intergenic
1031267867 7:119605038-119605060 GTATCTAGTAAGTAAAACCCAGG - Intergenic
1034080960 7:148277344-148277366 ACAGCAAGTAAGCAAAGGGCAGG - Intronic
1039538049 8:38337266-38337288 ACAGATACTAAGTAAAAGGTTGG - Intronic
1042610064 8:70588883-70588905 ACAGCTACTAATTAGAACGATGG + Intronic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1044943563 8:97368526-97368548 ACAGGTTGAAAGTAAAACGATGG + Intergenic
1047484291 8:125314816-125314838 AGAGCAATTAAGTAAAATGCTGG + Intronic
1048095424 8:131287025-131287047 ACAGCTAGTCAGTCAGAAGCAGG - Intergenic
1052028809 9:23605346-23605368 ACAGCTAGTAAATGGAACACTGG + Intergenic
1056739286 9:89239479-89239501 TCAGCTAGTAAGTACAGAGCTGG - Intergenic
1060814817 9:126629485-126629507 ACAGCTAGTAAATGGAACCCAGG + Intronic
1061175529 9:128993916-128993938 GCAGCTAGTTAGCAAAAGGCAGG - Intronic
1187079575 X:15972753-15972775 AAGGCTAGTAAGTAAAGCTCTGG + Intergenic
1188247913 X:27856550-27856572 ACAGCTAGTAAGTGACAGGATGG + Intergenic
1190431682 X:50384062-50384084 ACAGCTAGTAAGTAAGAGAAAGG + Intronic
1194340947 X:92704876-92704898 CCAGCTAGTAAGTGACAGGCAGG - Intergenic
1198581097 X:138065437-138065459 ACAGCTAGTAAGAACAGAGCTGG + Intergenic
1200319043 X:155165709-155165731 ACAGCTCTCAAGAAAAACGCTGG - Intergenic
1200649301 Y:5821595-5821617 CCAGCTAGTAAGTGACAGGCAGG - Intergenic
1201317318 Y:12660623-12660645 AAAGTTAGTAAGTATAAGGCAGG + Intergenic