ID: 999924069

View in Genome Browser
Species Human (GRCh38)
Location 5:156355964-156355986
Sequence TTTTTCTTCTAGAAGTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999924066_999924069 2 Left 999924066 5:156355939-156355961 CCCAGAATGAGAAAGATGGACAT 0: 1
1: 0
2: 2
3: 24
4: 323
Right 999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG No data
999924061_999924069 18 Left 999924061 5:156355923-156355945 CCTCCATATTCCCTGACCCAGAA 0: 1
1: 0
2: 2
3: 33
4: 589
Right 999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG No data
999924062_999924069 15 Left 999924062 5:156355926-156355948 CCATATTCCCTGACCCAGAATGA 0: 1
1: 0
2: 1
3: 25
4: 275
Right 999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG No data
999924064_999924069 7 Left 999924064 5:156355934-156355956 CCTGACCCAGAATGAGAAAGATG 0: 1
1: 0
2: 0
3: 18
4: 288
Right 999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG No data
999924067_999924069 1 Left 999924067 5:156355940-156355962 CCAGAATGAGAAAGATGGACATC 0: 1
1: 0
2: 1
3: 15
4: 169
Right 999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG No data
999924063_999924069 8 Left 999924063 5:156355933-156355955 CCCTGACCCAGAATGAGAAAGAT 0: 1
1: 0
2: 1
3: 22
4: 235
Right 999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999924069 Original CRISPR TTTTTCTTCTAGAAGTGTGA GGG Intronic
No off target data available for this crispr