ID: 999924604

View in Genome Browser
Species Human (GRCh38)
Location 5:156361087-156361109
Sequence TGGGGCCTGCAGCAGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 2, 2: 7, 3: 71, 4: 543}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999924604_999924610 5 Left 999924604 5:156361087-156361109 CCTGGGTGCTGCTGCAGGCCCCA 0: 1
1: 2
2: 7
3: 71
4: 543
Right 999924610 5:156361115-156361137 AGCTTGCTCCTGCTGGAGCCTGG 0: 1
1: 1
2: 11
3: 86
4: 451
999924604_999924609 -2 Left 999924604 5:156361087-156361109 CCTGGGTGCTGCTGCAGGCCCCA 0: 1
1: 2
2: 7
3: 71
4: 543
Right 999924609 5:156361108-156361130 CATATGGAGCTTGCTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999924604 Original CRISPR TGGGGCCTGCAGCAGCACCC AGG (reversed) Intronic