ID: 999932749

View in Genome Browser
Species Human (GRCh38)
Location 5:156451335-156451357
Sequence ATAGATTTCAACAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999932746_999932749 -2 Left 999932746 5:156451314-156451336 CCAAAGGACCTTGATTAATGCAT 0: 1
1: 0
2: 1
3: 14
4: 133
Right 999932749 5:156451335-156451357 ATAGATTTCAACAAGCAGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 171
999932747_999932749 -10 Left 999932747 5:156451322-156451344 CCTTGATTAATGCATAGATTTCA 0: 1
1: 0
2: 2
3: 19
4: 233
Right 999932749 5:156451335-156451357 ATAGATTTCAACAAGCAGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 171
999932745_999932749 -1 Left 999932745 5:156451313-156451335 CCCAAAGGACCTTGATTAATGCA 0: 1
1: 0
2: 1
3: 14
4: 141
Right 999932749 5:156451335-156451357 ATAGATTTCAACAAGCAGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999932749 Original CRISPR ATAGATTTCAACAAGCAGGA AGG Intronic
902726793 1:18341711-18341733 AGAGATGTTAACATGCAGGATGG - Intronic
905585246 1:39112068-39112090 AAAGATTTGAATAATCAGGAAGG - Intronic
907222531 1:52917466-52917488 AAAGATTTCCATAAGCAGAAAGG + Intronic
908186669 1:61658965-61658987 AAAGATTTCAAGAAGCAGGTGGG - Intergenic
909664084 1:78114440-78114462 ATAGACAAAAACAAGCAGGATGG - Intronic
909833734 1:80227498-80227520 ATAGATTTAAACATGCTGTATGG + Intergenic
910999940 1:93153227-93153249 ATAGACTTCAAAAAGCTAGATGG + Exonic
911003981 1:93199043-93199065 ACAGATTTCTAGAAGTAGGAGGG + Intronic
911540435 1:99151317-99151339 ATCGATTGCAATAAACAGGAAGG - Intergenic
914792942 1:150895308-150895330 AAAGATTTCCCCAAACAGGAAGG - Intergenic
916450311 1:164914564-164914586 ATAGATCTCTCCAAGCATGAAGG + Intergenic
916836578 1:168552017-168552039 ACAGCTTTCAACAACTAGGAGGG - Intergenic
917254856 1:173103579-173103601 ATAGCTCTCAGCAAGCTGGATGG + Intergenic
918751325 1:188273378-188273400 ATAGATTTCATCTACCAGTATGG - Intergenic
921125974 1:212178480-212178502 GCAGATTCCAGCAAGCAGGAAGG - Intergenic
921624264 1:217360731-217360753 ATATATTTCAAGCCGCAGGATGG - Intergenic
921903509 1:220473045-220473067 AAATAATTCAACAAGAAGGAAGG + Intergenic
922395884 1:225201131-225201153 ATAGAATTGAACAAGCAGAAGGG - Intronic
924147994 1:241097194-241097216 ATGGAATTTAACAAGCAGAATGG + Intronic
924436009 1:244043399-244043421 TTGGATTTAAACAAGCAGAAAGG - Intergenic
924712436 1:246540641-246540663 ATACATTTCAACAAACTGAAAGG + Exonic
1065177938 10:23096417-23096439 GCACATTTCACCAAGCAGGAAGG + Intronic
1065755127 10:28924064-28924086 GCAGAATTCAACCAGCAGGAAGG - Intergenic
1071085524 10:81864402-81864424 ATGCATTTTAACAAACAGGAAGG - Intergenic
1072121685 10:92410444-92410466 CTTGATTCCAACAGGCAGGATGG - Intergenic
1072451032 10:95539881-95539903 ATACCTTTGAACTAGCAGGAAGG - Intronic
1072482525 10:95822864-95822886 GTAGATTTCAAAAATGAGGAGGG + Intronic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1079165059 11:18032840-18032862 CAAGATTTCAACAAGCGGGCCGG - Intronic
1080789261 11:35506821-35506843 ATAAATATCCACATGCAGGAAGG - Intronic
1085238910 11:75035781-75035803 ATATATATTAACAAGCAGTAAGG + Intergenic
1085371498 11:76010915-76010937 AGGGACTTCAAGAAGCAGGATGG + Intronic
1085763691 11:79263837-79263859 ACAGATTTCAATAAACTGGAGGG - Intronic
1086184988 11:84002649-84002671 AGAGATTTCATAAAGCAGCAAGG + Intronic
1086553886 11:88086935-88086957 AAAGATTTTAAAAAGCAGGCTGG + Intergenic
1086817893 11:91396187-91396209 TTACATTCCAACAAGCAGTAGGG - Intergenic
1088131128 11:106492334-106492356 TTAGATTTCCACAATCAAGAAGG - Intergenic
1089403193 11:118176700-118176722 GTGGATTTCAAAAAGCAGGTGGG + Intergenic
1093139618 12:15493355-15493377 ATAGATTTCAGCAAGAAAAAAGG + Intronic
1097570278 12:61323676-61323698 AAAAATTACAAAAAGCAGGAGGG + Intergenic
1098111944 12:67132200-67132222 ATAGATGTCAGCAAGTGGGATGG + Intergenic
1098243976 12:68497293-68497315 ATAGAACCCAACCAGCAGGATGG + Intergenic
1098446323 12:70569398-70569420 TTAAATTTTAACAAGCAGGCTGG - Intronic
1099852621 12:88121670-88121692 GTGGATTTCAGCTAGCAGGAAGG - Intronic
1100271091 12:93025415-93025437 ATAGATTTTAACTAGCAGTTAGG + Intergenic
1102677378 12:114667926-114667948 AGAGATTTCTACAAGCAGCAAGG + Intergenic
1102745109 12:115243539-115243561 ATAGAAATCCACAAGAAGGAAGG + Intergenic
1102892602 12:116572196-116572218 ATAGATTGCCAGAAGCAGCACGG + Intergenic
1102900523 12:116633097-116633119 ATAGGCTTCAACAAGAAGAAGGG - Intergenic
1105784388 13:23734275-23734297 AGAGAGTTCAATAAGCAAGAAGG - Intronic
1106941088 13:34779849-34779871 GTAGATTTCCACATTCAGGAGGG - Intergenic
1109507776 13:63329133-63329155 ACAGTTTTGAACAAGCAGAAGGG - Intergenic
1109942757 13:69393015-69393037 ATGGGTTTCACCATGCAGGATGG - Intergenic
1110022506 13:70492585-70492607 ATAGATATCAAGAAGCGGGGAGG - Intergenic
1111875999 13:93896468-93896490 ATAAACTTCAGCAAGCAAGAAGG + Intronic
1111896864 13:94152910-94152932 ATAGATTTCAAAACTCATGAAGG - Intronic
1115468421 14:33741809-33741831 AGAGATTTCAGGAAGCAGGTAGG + Intronic
1116430849 14:44843760-44843782 ATTGGATCCAACAAGCAGGAGGG + Intergenic
1116625984 14:47264113-47264135 ATTGTTTTCAAGAAGCAGGGAGG + Intronic
1116863612 14:50014014-50014036 ATACATTTTAACAAACTGGAAGG + Intergenic
1117484759 14:56183747-56183769 ATTGATTTCATGAAGCTGGAAGG + Intronic
1118027290 14:61782353-61782375 AAAGATTGAAACCAGCAGGAAGG + Exonic
1118895438 14:69941825-69941847 AAAGATTTTCACAAGTAGGAAGG - Intronic
1119843115 14:77808121-77808143 ATGGAGTTCAACCAGCAGGTGGG + Intronic
1122757509 14:103993908-103993930 TTAGCTTTCAGCAAACAGGACGG + Intronic
1122971700 14:105154885-105154907 ATGGATTTGATCAAGCAGGAAGG - Intronic
1126959904 15:53980163-53980185 ATAGTTTTCAAAGAGCAGGGTGG - Intergenic
1127190459 15:56525195-56525217 ATAGAATTAAACAAAAAGGAGGG - Intergenic
1127481892 15:59385349-59385371 ATAAATTTCCAAAAGCAGGAGGG - Intronic
1128486636 15:68097727-68097749 ATAAATTACAACATGCAGGCTGG - Intronic
1130217590 15:81986911-81986933 ATAGATTTCCAAGAGCTGGAAGG + Intergenic
1131419334 15:92291151-92291173 GGAGATTTGAACAGGCAGGAGGG - Intergenic
1133141431 16:3747569-3747591 CTAGACTACAACCAGCAGGAAGG + Intronic
1133893141 16:9900572-9900594 AAAGATTTCAACTAGAAGCAGGG + Intronic
1134907713 16:17995273-17995295 AGACATTTCAACAAAGAGGAGGG - Intergenic
1138721192 16:59082380-59082402 GTAGATTCCAAAAGGCAGGAGGG + Intergenic
1138791788 16:59912943-59912965 TAAGATTTCATCAAGGAGGAAGG + Intergenic
1139368392 16:66448098-66448120 AGGGATTGCAACAGGCAGGAGGG - Intronic
1139387327 16:66581124-66581146 ATAGTTTTTAACAAGAAGGCAGG - Intronic
1143066672 17:4254613-4254635 ACAGATTTCCACAAGCTAGATGG - Intronic
1143227593 17:5320005-5320027 ATAAATATCCACATGCAGGAAGG + Intronic
1143968123 17:10771598-10771620 ATAGTGTTCAACAAACACGAAGG + Intergenic
1147841388 17:43374273-43374295 ACAAATTTCACCAAGAAGGAGGG + Intergenic
1152647599 17:81476832-81476854 CTACATTCCAACTAGCAGGAAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1157956189 18:52100118-52100140 AAAGATTAGAACAAGCAGCATGG - Intergenic
1158057568 18:53300206-53300228 ATAAATTTTAGCAAGCAGGCAGG - Intronic
1158346427 18:56521186-56521208 ATAGATTTTAACTAGTAAGAAGG + Intergenic
1158513801 18:58114483-58114505 ATGGATTTTAAAAAGCAAGACGG - Intronic
1162363621 19:10234381-10234403 AAAGATTTCAAACAGCAGGCTGG - Intergenic
925121071 2:1418862-1418884 TTAAATTTCAACAAACAGCAAGG + Intronic
925786202 2:7433313-7433335 ATAGATTTCAAAGATTAGGAAGG + Intergenic
926866857 2:17369681-17369703 ATAGAATTGAACAAGTAGAAGGG - Intergenic
927814012 2:26198108-26198130 ATTGATTTCAACACCCAGCATGG + Intronic
928210359 2:29319394-29319416 AGAGATCTCAGCAAGCATGAGGG + Intronic
930306096 2:49676519-49676541 AAGGATTTCACCAAGCAGGAGGG + Intergenic
933374733 2:81464957-81464979 ACAGATTTCAGCAACCAGGTGGG - Intergenic
937934206 2:127229676-127229698 AAAGATGTCACAAAGCAGGATGG - Intergenic
938943753 2:136192022-136192044 ATAGATTCCAAAAAGTTGGATGG - Intergenic
938999288 2:136715155-136715177 ATAGATTTCTTCAGGCAGTATGG - Intergenic
940002222 2:148977815-148977837 ATAGATATCACCAAACAGGCTGG + Intronic
941388382 2:164881188-164881210 ATAAATTTCAAGAAGAAGGAAGG - Intergenic
943063827 2:183066590-183066612 ATAGATTTCTAGAAGAAGGTAGG + Intergenic
946080870 2:217117162-217117184 GGAGATTTCCACAAGCAGCAGGG + Intergenic
947267985 2:228303663-228303685 ATACATTTCAACACTCAGGATGG - Intergenic
948639935 2:239369172-239369194 ACAGATGCCAACAAGCGGGAAGG + Intronic
948939124 2:241187501-241187523 AGGGATTTCAACAGGCAGAAGGG + Intergenic
1173344124 20:42183105-42183127 ATAGATTTTAAGAAGTAGAAAGG - Intronic
1173591940 20:44231586-44231608 AAAGGTTCAAACAAGCAGGAAGG - Intergenic
1173637169 20:44570370-44570392 ATACATTTCCACAACTAGGATGG + Intronic
1183392844 22:37555569-37555591 ATAGATACCAACATGGAGGATGG + Intergenic
1183461665 22:37954595-37954617 CTAGATTACTACAAGCAGGCCGG - Intronic
950397967 3:12748762-12748784 ACAGATTTCCACAAGCAAGATGG - Exonic
951738270 3:25892096-25892118 ATAGATTTCTGCAAGAAGGAAGG + Intergenic
953725839 3:45398022-45398044 ATGGATTTATACAAACAGGATGG - Intronic
956879875 3:73499710-73499732 TTAGATTACAAAAAGCAGTAAGG + Intronic
957484892 3:80847285-80847307 ATAGATGTCAACATACTGGAAGG - Intergenic
958454580 3:94314556-94314578 ATAAGTTTCAGCAAGAAGGAAGG + Intergenic
959294228 3:104514744-104514766 ATAGATTGGAACAAGCAGAATGG + Intergenic
960790461 3:121424873-121424895 ATTGTTTTCAAAAAGCAGGGAGG + Intergenic
962266351 3:133947162-133947184 ATAGAGTTAAGGAAGCAGGAAGG + Intronic
963537806 3:146549896-146549918 ATAGATTTCAAAAAGAGGCACGG - Intergenic
964390072 3:156187485-156187507 GGAGAGTTCAAGAAGCAGGATGG - Intronic
964812256 3:160678469-160678491 ATAGATTTCAAAAAGCTGGCAGG - Intergenic
966199895 3:177351371-177351393 ATAGCTCTCCCCAAGCAGGAAGG + Intergenic
966541070 3:181090260-181090282 CTAGATTTCCAAAAGCAGAAAGG - Intergenic
966918199 3:184596279-184596301 AGATATTTCAACCAGCAGAAGGG + Intronic
968933376 4:3596327-3596349 AAAGATGTCAACAGGCAGGTCGG - Intergenic
971634385 4:29037639-29037661 ATAGCTTTCAACTAGCAAAAAGG - Intergenic
975491004 4:74988798-74988820 ATAGATTTAAACAGGCAAAATGG + Intronic
977073211 4:92419090-92419112 CTACATTTTAACAAGCAAGAAGG - Intronic
979117107 4:116839396-116839418 ATAAATTTCTTCAAGCAGTATGG - Intergenic
979252858 4:118583542-118583564 ACAGAATTCAACGATCAGGAAGG + Intergenic
980082828 4:128362500-128362522 ACAGATTTATACTAGCAGGAGGG - Intergenic
988248798 5:28726699-28726721 CTACATTTGAAGAAGCAGGAAGG - Intergenic
989101303 5:37825797-37825819 AGTGATTTGAACAAGAAGGAGGG + Intronic
989559924 5:42838357-42838379 ATAGTATTCAACAGGCAGGCAGG + Intronic
992315021 5:75543697-75543719 TTAGGTATCAATAAGCAGGAAGG + Intronic
994110251 5:95994868-95994890 ACACATTTTAACAAGCAGAAAGG + Intergenic
994268864 5:97753066-97753088 ATAGATTTCAACATACATGTGGG + Intergenic
999480462 5:151943202-151943224 ACAGATTTGTACAAGCAGGAGGG - Intergenic
999632269 5:153583281-153583303 ACAAAATTCCACAAGCAGGATGG + Intronic
999932749 5:156451335-156451357 ATAGATTTCAACAAGCAGGAAGG + Intronic
1002787330 6:412583-412605 ATAGTTTGGAACAAGCAGAAAGG + Intergenic
1002794539 6:461589-461611 AATGATTTCCACAAGCAAGATGG + Intergenic
1006434614 6:34019732-34019754 TTAGATTTCAACAAGATGGGGGG - Intronic
1010515267 6:76765481-76765503 ATAGAGTTTGACAAGCAAGATGG - Intergenic
1010785317 6:79993650-79993672 AAAGATAGCAACAAGCATGAGGG - Intergenic
1013641962 6:112093000-112093022 ATAGAGTACAAAAAGCAAGATGG + Intronic
1013730526 6:113159675-113159697 ATAAATTTGAACAAGCTGCAAGG - Intergenic
1014096599 6:117468212-117468234 AAAGATTGCAACAAGGACGATGG + Intronic
1017557488 6:155587639-155587661 ATGGATTTCCACAAGTATGATGG + Intergenic
1023136244 7:37055613-37055635 AGAGATTTCCACCCGCAGGAGGG - Intronic
1024570081 7:50716002-50716024 ACAGAGTTCAACACTCAGGAAGG + Intronic
1027351689 7:77318104-77318126 ATAAAATTCAAGAAGCAGCATGG + Intronic
1027529185 7:79309233-79309255 AGAGATTATAACATGCAGGATGG + Intronic
1035837005 8:2765106-2765128 ATTAATTTCCACAATCAGGAAGG - Intergenic
1038412191 8:27367451-27367473 GTCCATTTCAACAAGGAGGAAGG + Intronic
1038588103 8:28809777-28809799 TTTGATTTCAATAACCAGGAAGG + Intronic
1038833486 8:31091008-31091030 CTAGATTTTAACATGCATGATGG - Intronic
1039535145 8:38303726-38303748 ATAGAATCTAACAAGCATGATGG + Intronic
1045799604 8:106087204-106087226 ATTGATTTGAGCAAGCAGGGGGG + Intergenic
1045918285 8:107499673-107499695 AGAGATTTCCAAAAGCAGGCTGG - Intergenic
1046040957 8:108903872-108903894 CAAGATTTCAACATGCAGAAAGG - Intergenic
1046641672 8:116738533-116738555 CTGGTTTTCAACAAGCAGAAAGG + Intronic
1047183535 8:122612000-122612022 GTAGATTAAAACAAGGAGGAGGG - Intergenic
1048038115 8:130696966-130696988 ATAAATTCCAAAAAGTAGGATGG + Intergenic
1048180705 8:132192007-132192029 TTAGATTTCAATCAGCCGGATGG - Intronic
1055550340 9:77427091-77427113 ATACATATCTACAACCAGGAGGG + Intronic
1057347167 9:94260680-94260702 ATGGGTTGCAACAAGCAGAATGG + Intronic
1059037074 9:110765986-110766008 AAAAATCTGAACAAGCAGGATGG - Intronic
1060045523 9:120337185-120337207 AGAGCCTTCAAGAAGCAGGAGGG + Intergenic
1060832335 9:126724262-126724284 ATAGATGGCACCAGGCAGGAAGG + Intergenic
1186125455 X:6409013-6409035 ATAAATTTCAACAAACAGATTGG - Intergenic
1186645403 X:11501472-11501494 ATAAATTTGTACAAGCAGGTTGG + Intronic
1187096152 X:16150639-16150661 ATACATGTCAAGAAGCAGGTAGG + Exonic
1189731961 X:44030266-44030288 ATGGATTTGAACTAGCAGGGAGG + Intergenic
1190216482 X:48482405-48482427 CCAGATTTCAACCAGCTGGATGG + Exonic
1191157529 X:57290581-57290603 ATAAACTGCAACAAGCATGATGG - Intronic
1192104427 X:68300179-68300201 ATAGGTTTGAAAATGCAGGATGG - Intronic
1194190687 X:90833675-90833697 ATGGAGTTCAAGAAACAGGAAGG - Intergenic
1194866594 X:99076614-99076636 ATACAGTTCAACAAGCATTACGG + Intergenic
1198557762 X:137813976-137813998 AGAGATAAGAACAAGCAGGATGG + Intergenic
1199354896 X:146850700-146850722 AGAGTTTTAAACAAGCTGGAGGG - Intergenic
1200537344 Y:4416096-4416118 ATGGAGTTCAAGAAACAGGAAGG - Intergenic