ID: 999933156

View in Genome Browser
Species Human (GRCh38)
Location 5:156455684-156455706
Sequence TAGGCTATTACAGTGATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999933152_999933156 6 Left 999933152 5:156455655-156455677 CCAGCACTTTCTCCTGTCCAGCT 0: 1
1: 0
2: 3
3: 35
4: 368
Right 999933156 5:156455684-156455706 TAGGCTATTACAGTGATTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 102
999933154_999933156 -6 Left 999933154 5:156455667-156455689 CCTGTCCAGCTTCTTGATAGGCT 0: 1
1: 0
2: 0
3: 13
4: 136
Right 999933156 5:156455684-156455706 TAGGCTATTACAGTGATTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999933156 Original CRISPR TAGGCTATTACAGTGATTGA AGG Intronic
901542260 1:9926358-9926380 TATCTTATTACAGTGAATGATGG - Intronic
905020082 1:34804073-34804095 TATGCTATTAAAATGATTGCAGG - Intronic
911765263 1:101666835-101666857 TGGGCTATTACATTGCTTCATGG - Intergenic
912635316 1:111286407-111286429 GAGGCTATTGCAGTGATTCAGGG + Intergenic
922004074 1:221511212-221511234 TAGGGTGCTACAGGGATTGATGG + Intergenic
1062821798 10:540506-540528 TAGGCTTTTTCAGTGAGAGAAGG - Intronic
1062986925 10:1777614-1777636 TAGGTTATTATAGTATTTGATGG - Intergenic
1066238157 10:33507226-33507248 GAGGATATTACATTGATTTATGG - Intergenic
1066542153 10:36458869-36458891 CAGGCTATATCAGTGATTAAAGG + Intergenic
1070449545 10:76544087-76544109 TAAGCCATTACGGTAATTGAGGG - Intronic
1071886892 10:89961150-89961172 TAGGAGATTTGAGTGATTGAGGG + Intergenic
1071957497 10:90775314-90775336 TAGACAATTACAGGGATAGAGGG + Intronic
1074291302 10:112139812-112139834 AGGGCTCTGACAGTGATTGACGG + Intergenic
1086142170 11:83511521-83511543 TAGGCTATTATAGTGCTAAATGG + Intronic
1089643858 11:119865215-119865237 GAGGCTCTCCCAGTGATTGATGG - Intergenic
1090001758 11:122967089-122967111 TTGGCATTTACAGTGAGTGATGG - Intergenic
1092321962 12:7485659-7485681 AAGCCTATTAGAATGATTGAGGG - Intronic
1093207221 12:16264940-16264962 TGGACTAATACAGTGATTAAGGG + Intronic
1095585633 12:43846247-43846269 TAGGATATTTCAGAGACTGAGGG + Intronic
1097667314 12:62494804-62494826 TAGGATATTACAATTTTTGAGGG + Intronic
1097834629 12:64260596-64260618 TAGGCTATTACAGTAGTTGCTGG + Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1106682438 13:32022057-32022079 CAGGCTATTACAATGAGGGAAGG + Intergenic
1107142164 13:37012038-37012060 TAAACTATTAAATTGATTGATGG - Intronic
1107746595 13:43517062-43517084 TATGCTAATCCAGTGATGGAAGG + Intronic
1108264467 13:48691357-48691379 TAGGGTGTTACAGTGATGAATGG + Intronic
1109170602 13:59092545-59092567 CAGGATATTAAAGTGAATGATGG + Intergenic
1110594365 13:77302652-77302674 TATGATATTACAGTTATTAAAGG - Intronic
1111262310 13:85757287-85757309 TAAGATTTTATAGTGATTGATGG + Intergenic
1113976379 13:114230934-114230956 TAGGCTATTACAGGTATAGAAGG + Intergenic
1116505323 14:45670686-45670708 TAGGAAATTGCAGTCATTGAGGG + Intergenic
1117180148 14:53183258-53183280 TATGCTAATAAAGTGATTTAGGG + Intergenic
1118960608 14:70526863-70526885 TAGGCTGTGACTGTGAGTGAGGG - Intronic
1131818316 15:96245770-96245792 AAGGCTGTTACAGGGATTAAAGG + Intergenic
1131896815 15:97042347-97042369 TATAGTATTACATTGATTGATGG - Intergenic
1135013575 16:18905305-18905327 CAGGCTATTAGATTGATAGAGGG - Intronic
1135320514 16:21492872-21492894 CAGGCTATTAGATTGATAGAGGG - Intergenic
1135373349 16:21924362-21924384 CAGGCTATTAGATTGATAGAGGG - Intergenic
1135438440 16:22446340-22446362 CAGGCTATTAGATTGATAGAGGG + Intergenic
1136330732 16:29574577-29574599 CAGGCTATTAGATTGATAGAGGG - Intergenic
1136445367 16:30314293-30314315 CAGGCTATTAGATTGATAGAGGG - Intergenic
1137866057 16:51897821-51897843 TAGGCTTTCACAGTTATTTAAGG - Intergenic
1139778666 16:69332899-69332921 TAGGCTGTCCCAGTAATTGACGG - Intronic
1142514408 17:417747-417769 CAGGCGAATACAGTGTTTGATGG + Intronic
1150655877 17:67039084-67039106 TAGGCTAACAATGTGATTGATGG - Intergenic
1154048387 18:10929663-10929685 TAGTCTTTTACAGTGTTTAATGG + Intronic
1156053503 18:32969340-32969362 GATGTTACTACAGTGATTGAGGG - Intronic
1161740632 19:6018936-6018958 TAGGCTACTTGAGTGATTCAGGG - Intronic
1167033000 19:46975959-46975981 TAAACTGTTACAGTGATAGATGG - Intronic
925493242 2:4419023-4419045 CAGGCTATTGGAGTGACTGATGG + Intergenic
925613741 2:5725676-5725698 TAGAGTATTCCAGTGATTTAAGG + Intergenic
926448639 2:12974592-12974614 TTGGTTGTAACAGTGATTGAGGG + Intergenic
930161635 2:48164304-48164326 TAGGATATTACAGTGACTCTGGG + Intergenic
930513322 2:52374040-52374062 AAGGCTCTCACAGTGATGGATGG - Intergenic
930659944 2:54043367-54043389 TTGGTTATCACAGTGATTGAAGG + Intronic
935745476 2:106186849-106186871 AAGGCTATCACAGTCATTTATGG + Intronic
936736410 2:115447829-115447851 TGGGCTATTATAGTCAGTGAGGG + Intronic
937666122 2:124489177-124489199 CAGACTAATACAGTGATAGAAGG - Intronic
945697215 2:213122253-213122275 GAGACTATTTTAGTGATTGATGG + Intronic
948312700 2:237000599-237000621 TAAGGTAATACAGGGATTGAGGG - Intergenic
1169685136 20:8262551-8262573 TAGACTCTTCCAGTGACTGAAGG - Intronic
1169703520 20:8476064-8476086 AAGGCTATTACAGTCATTTCCGG + Intronic
1170315252 20:15034076-15034098 TAGCCTGTCACAGTGATTGATGG + Intronic
1170555400 20:17510873-17510895 TAGGCTACTACAGGGTTTGGTGG - Intronic
1172805632 20:37609713-37609735 CAGACTAATACAGTGGTTGAGGG - Intergenic
1173185207 20:40835144-40835166 GAGGCAATAACACTGATTGACGG + Intergenic
1178150736 21:29790829-29790851 TAGGATACCACAGTGAATGAAGG + Intronic
952194831 3:31064200-31064222 TAGGCTATTTCATTGATTCTTGG - Intergenic
954674104 3:52306271-52306293 GAGGCTGTCACAGTGATTTAAGG - Intergenic
959010671 3:101071873-101071895 TAGGCTATTGTATTGAGTGAGGG - Intergenic
959357080 3:105345279-105345301 CAGCCTAATACAGTGAATGAGGG - Intergenic
964240859 3:154592992-154593014 TTGGCTAATTCAGTGTTTGAGGG + Intergenic
966447517 3:180019503-180019525 CAGGCAATTTCAGTGATTTAAGG + Intronic
974354853 4:60798206-60798228 TAGACTATCACAGTGCTTAAAGG + Intergenic
974654178 4:64798380-64798402 TAGGCTTTTACAGTAACAGAGGG + Intergenic
976811298 4:89104057-89104079 TATGCTAATACAGTGACTTAGGG + Intronic
978755215 4:112294261-112294283 AAGGCAATCACAGTGACTGATGG - Intronic
979441151 4:120750588-120750610 TAGGCCGTTAATGTGATTGAGGG - Intronic
980841648 4:138268603-138268625 TAGGGGTTTACAGTGAATGAGGG - Intergenic
984032953 4:174627621-174627643 TGTGCTTCTACAGTGATTGATGG - Intergenic
993847915 5:92968501-92968523 TAGGCTAATATAGGGCTTGATGG - Intergenic
995260555 5:110099064-110099086 TATGCTATTACAGTCACTCAGGG - Intergenic
998299174 5:141001736-141001758 TGGGCTGTTTCAGTGGTTGATGG + Intronic
998831274 5:146162224-146162246 AAGGCTATAACAGTCATAGATGG - Intronic
999586819 5:153098596-153098618 TAGGCTAGTACAGCCATAGAGGG - Intergenic
999933156 5:156455684-156455706 TAGGCTATTACAGTGATTGAAGG + Intronic
1001182974 5:169538194-169538216 TAGCCCATAACAGAGATTGAAGG - Intergenic
1007392477 6:41558039-41558061 TAGGATGTCACAGTCATTGAGGG + Intronic
1008434947 6:51465161-51465183 TAGGAAATGACAGTGAATGAAGG - Intergenic
1012917939 6:105190696-105190718 TAGGGATTTCCAGTGATTGAAGG - Intergenic
1013047475 6:106501575-106501597 TAGCCTATGACAGTGATGGCTGG - Intergenic
1015046533 6:128782892-128782914 TAGGATATGACAGTGACTGAGGG - Intergenic
1018642794 6:165920005-165920027 TAGAGTATTGCAGTGATTTAGGG - Intronic
1023403455 7:39807664-39807686 TAGGCAATTTAATTGATTGATGG + Intergenic
1026311458 7:69188951-69188973 TAGTATGGTACAGTGATTGAGGG - Intergenic
1028825230 7:95264761-95264783 TAGGCTATTTCAGAGACTGGAGG + Intronic
1033708384 7:143911194-143911216 TAGACTATTGCAGTGACAGAAGG + Intergenic
1034887439 7:154808699-154808721 TGGGAAATTACAGGGATTGACGG + Intronic
1041832529 8:62171127-62171149 TATGCTTTTACATTGCTTGAAGG - Intergenic
1042714026 8:71752324-71752346 TAAGCTACTATAGTGATTCAAGG + Intergenic
1043103197 8:76073354-76073376 TATGCAATTACATTGATGGATGG + Intergenic
1046261270 8:111771400-111771422 TAGGCTATTACACTTTTTGGAGG + Intergenic
1046397332 8:113657211-113657233 ATGGCTTTTACAGTGATGGATGG + Intergenic
1051993716 9:23186920-23186942 AATGCTATAACAGTGATGGAAGG - Intergenic
1057225751 9:93292332-93292354 TAGGCTATGACAGAGATGGAAGG + Exonic
1058852149 9:109023196-109023218 TAGGGTGTTAGGGTGATTGATGG + Intronic
1060111799 9:120911726-120911748 TAAGCTAGGACAGTGGTTGAAGG - Intronic
1186171217 X:6879121-6879143 TAGACTTCTCCAGTGATTGAGGG - Intergenic
1187693555 X:21895843-21895865 TAGGCAATAACATTTATTGAGGG - Intergenic
1188887791 X:35571656-35571678 TAGGCTCTTCCAGTGATTTCTGG - Intergenic
1191661307 X:63654351-63654373 TAGGCTGTTAGAGTTATTAAAGG - Intronic