ID: 999935323

View in Genome Browser
Species Human (GRCh38)
Location 5:156479949-156479971
Sequence CAGGGCAAGACAGCAGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999935323_999935335 22 Left 999935323 5:156479949-156479971 CCAACAGCTGCTGTCTTGCCCTG 0: 1
1: 0
2: 2
3: 32
4: 328
Right 999935335 5:156479994-156480016 GATCAGCCCTCCAGCTGTCTTGG 0: 1
1: 0
2: 0
3: 16
4: 124
999935323_999935328 -6 Left 999935323 5:156479949-156479971 CCAACAGCTGCTGTCTTGCCCTG 0: 1
1: 0
2: 2
3: 32
4: 328
Right 999935328 5:156479966-156479988 GCCCTGGGAGGAGCCCCTGTGGG 0: 1
1: 0
2: 5
3: 38
4: 378
999935323_999935327 -7 Left 999935323 5:156479949-156479971 CCAACAGCTGCTGTCTTGCCCTG 0: 1
1: 0
2: 2
3: 32
4: 328
Right 999935327 5:156479965-156479987 TGCCCTGGGAGGAGCCCCTGTGG 0: 1
1: 0
2: 3
3: 55
4: 473
999935323_999935331 -3 Left 999935323 5:156479949-156479971 CCAACAGCTGCTGTCTTGCCCTG 0: 1
1: 0
2: 2
3: 32
4: 328
Right 999935331 5:156479969-156479991 CTGGGAGGAGCCCCTGTGGGTGG 0: 1
1: 0
2: 8
3: 51
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999935323 Original CRISPR CAGGGCAAGACAGCAGCTGT TGG (reversed) Intronic
900346118 1:2210990-2211012 CCGGGCAAGACAGGCGCTGCAGG - Intronic
900357830 1:2273261-2273283 TGTGGAAAGACAGCAGCTGTGGG + Intronic
900581473 1:3411896-3411918 CAGGGCACGACGGCAGCTGCGGG + Exonic
901400914 1:9014692-9014714 CATGGCCGGCCAGCAGCTGTCGG - Exonic
901656736 1:10773678-10773700 CAGGACAAGGCAGCAGGTGGGGG + Intronic
902578844 1:17395762-17395784 CAGGGAAGCACAGAAGCTGTTGG + Intronic
902881243 1:19373178-19373200 CAGGGCAAGCCAGGAGCTAGTGG + Intronic
903301372 1:22380732-22380754 CAGGGGAAGAGACCACCTGTAGG - Intergenic
905530834 1:38677489-38677511 CAGGAGAAGAGAGAAGCTGTGGG - Intergenic
905894403 1:41535598-41535620 CAGGGCAGGACAGAGGCTATGGG + Intronic
905942590 1:41875626-41875648 CAGGACACTCCAGCAGCTGTGGG + Intronic
907997258 1:59645251-59645273 CAGCGCCAGACAGTAGGTGTTGG + Intronic
911277434 1:95879292-95879314 CAGGCCATGAAAGCAGCTGCAGG - Intergenic
912430842 1:109627595-109627617 AAGGGCAAGACACCAGGTGATGG - Intronic
914245865 1:145885531-145885553 CAGGGCAAGTCAGAAGCTGCAGG + Intronic
915058390 1:153158507-153158529 CAGCTCAAGAAAGCAGCTGCAGG - Intergenic
917447020 1:175115116-175115138 CAGGGAAATACAGCAGTGGTTGG - Intronic
918760390 1:188397225-188397247 CAGGGCATTACTTCAGCTGTAGG - Intergenic
922650930 1:227337685-227337707 CAGGGAGAGACAGGATCTGTGGG + Intergenic
922718551 1:227888980-227889002 GAGAGCAAGACTGCAGCTGGCGG + Intergenic
923147735 1:231209797-231209819 CAGGGCAAAGCCACAGCTGTGGG - Intronic
1062765197 10:57192-57214 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG + Intergenic
1063461915 10:6220465-6220487 CACAGCCAGACACCAGCTGTGGG + Intronic
1063494462 10:6494190-6494212 TAGGGCAAGACAGTTGCTGATGG - Intronic
1063535241 10:6876748-6876770 CAGGGCCAGCCAGCAGCCGGGGG + Intergenic
1063891887 10:10638723-10638745 CAGGGCAAGGCAATAACTGTTGG + Intergenic
1066177489 10:32924139-32924161 GGGGACAAGACAGCAGCAGTGGG - Intronic
1068228077 10:54132922-54132944 CAAGGCTATACATCAGCTGTGGG + Exonic
1068449294 10:57165353-57165375 CAGCCCATGAAAGCAGCTGTAGG - Intergenic
1069778653 10:70941368-70941390 CAGGGCTAGGCGGCGGCTGTTGG + Intergenic
1072871427 10:99124695-99124717 CAAGGCCAGACAGCAGGAGTAGG + Intronic
1073716607 10:106114960-106114982 GAGCGCAGCACAGCAGCTGTGGG + Intergenic
1073838533 10:107471609-107471631 AAGGGCAAGAGAGCAACAGTGGG + Intergenic
1075433812 10:122416313-122416335 CAGGGAAAGAGAGCTGTTGTGGG + Intronic
1076337450 10:129717925-129717947 CAGAGCAAGGCAGGAGCTGTGGG - Intronic
1076616585 10:131759158-131759180 CAGGGCGAGCCAGCTGCTGAGGG - Intergenic
1077125554 11:934051-934073 CAGGGACACACAGCAGCTGTGGG - Intronic
1077230224 11:1455343-1455365 CAGGGCAGGACAGCAGCCCTGGG - Intronic
1077491555 11:2863055-2863077 CCGGGCAAGACGGCAGACGTGGG + Intergenic
1077555368 11:3223511-3223533 CAGGGCCACAGAGCTGCTGTAGG - Intergenic
1078697622 11:13650345-13650367 CAGGGCAAGACAGAAGGAGAAGG - Intergenic
1078994726 11:16685629-16685651 TAGTGCATGAGAGCAGCTGTGGG - Intronic
1082992206 11:59217010-59217032 CAGAGAAAGAAAGCAGATGTGGG - Intergenic
1083349670 11:62018470-62018492 CAAGCCAATTCAGCAGCTGTTGG + Intergenic
1084434664 11:69131910-69131932 CAGGGAAAGGCAACAGCTGGTGG - Intergenic
1084498636 11:69521085-69521107 CAGCCCATGAAAGCAGCTGTGGG - Intergenic
1084609425 11:70192863-70192885 CAGGCCAAGGCAGCAGCTGCTGG + Intergenic
1084773386 11:71358559-71358581 CTGGGCAGGGCAGCAGCTGCAGG + Intergenic
1084928508 11:72534723-72534745 CATGGCAAGAGTGCAGCTGAGGG - Intergenic
1085369465 11:75986470-75986492 CACAGCAAGACTGCAGCTGCAGG - Intronic
1085570978 11:77557811-77557833 GATGGCAAAACAGCAGGTGTGGG - Intronic
1085645280 11:78218599-78218621 CATGGCAGGACAGCTGCTGTGGG - Exonic
1087294228 11:96350999-96351021 CAGGGCTATACAGAAGCTTTAGG - Intergenic
1088847798 11:113682373-113682395 CAGGGCAAGGCAGCATCTGCTGG + Intergenic
1089060188 11:115620009-115620031 CAGGGGAAGGGAGCAGCAGTGGG + Intergenic
1089609154 11:119660013-119660035 AAGGAGAAGCCAGCAGCTGTTGG - Intronic
1090136321 11:124203168-124203190 GACAGCAGGACAGCAGCTGTGGG - Intergenic
1090505071 11:127302340-127302362 CAGAGCAATACAGCAGGTATAGG + Intergenic
1091753550 12:3037496-3037518 CAGGGCAAGAGACCGGCAGTGGG - Intronic
1092135404 12:6143540-6143562 CAGAGCAAGACTCCAGCTGGGGG - Intergenic
1092524190 12:9299481-9299503 CAGGGCCAGAAAGCCGCTCTTGG + Intergenic
1092543076 12:9432331-9432353 CAGGGCCAGAAAGCCGCTCTTGG - Intergenic
1093435552 12:19130497-19130519 GGGGGCAAGACGGCAGCTGGGGG - Intronic
1093473440 12:19529328-19529350 CAGGGCAGAACAGCAGCCTTTGG - Intronic
1093730074 12:22557067-22557089 AAGGGCAAGACAGCTGTTGGGGG - Intergenic
1094152746 12:27303352-27303374 CTGGGCAAAGCAGCAGCTTTAGG + Intronic
1094411789 12:30174593-30174615 CTGGGCAAGACATCACATGTCGG - Intergenic
1095101586 12:38190572-38190594 CAGTCCATGAGAGCAGCTGTGGG + Intergenic
1095753054 12:45730730-45730752 CAAGGCTAGGCAGAAGCTGTAGG + Intronic
1096219742 12:49821522-49821544 CAGGCCAGGACTGCAGATGTGGG - Intronic
1096326994 12:50672315-50672337 CAAGACAAGTCATCAGCTGTTGG - Intronic
1096431932 12:51551978-51552000 CAGGGAAATACAGCAGCAGGGGG - Intergenic
1098771545 12:74559428-74559450 CAGCCCATGAAAGCAGCTGTAGG - Intergenic
1100164502 12:91901167-91901189 CAGCTCATGAAAGCAGCTGTGGG + Intergenic
1100224304 12:92540695-92540717 CTGGGAAACACAGCAGCAGTCGG + Intergenic
1101738109 12:107478783-107478805 CAGGGCAAGGAAGCAACTCTTGG - Intronic
1102156518 12:110734198-110734220 CAGAGCAGGACTGCTGCTGTGGG - Intronic
1103352970 12:120298261-120298283 CAGCGAAAGTCAGTAGCTGTAGG - Intergenic
1103915292 12:124372798-124372820 CAGGCGAGGGCAGCAGCTGTGGG - Intronic
1104945888 12:132414768-132414790 CAGGGCAGGGCAGAGGCTGTGGG + Intergenic
1106408924 13:29497511-29497533 CTGAGACAGACAGCAGCTGTGGG + Intronic
1106498740 13:30307284-30307306 GAGGGCGAGACAGCAGGTGGTGG - Intronic
1106875058 13:34062867-34062889 TAGGTAAAGACAGCAGCTGGGGG - Intergenic
1111419890 13:87998718-87998740 CAGCCCATGACAGCAGCTATGGG + Intergenic
1112415839 13:99202708-99202730 CAGGCCAAGACAGCTGCAGAGGG - Intronic
1112605151 13:100897220-100897242 CAGGGCCTCACAGCAGCTGAAGG - Intergenic
1113431336 13:110254190-110254212 GAGGGATAGACAGCAGCTGTTGG - Intronic
1113501820 13:110781889-110781911 CAGCTCATGAAAGCAGCTGTGGG - Intergenic
1113513391 13:110872950-110872972 CTCGACAACACAGCAGCTGTAGG + Intergenic
1115363994 14:32535619-32535641 CAGAGTAAGACAGCAGCTTTAGG - Exonic
1117081288 14:52154793-52154815 CAGGAAAAGGCAGCAGCTGGAGG + Intergenic
1117498874 14:56332048-56332070 CAGTTCAGCACAGCAGCTGTAGG + Intergenic
1118822986 14:69357169-69357191 CAGGGGAAGGCAGGAGCTATGGG + Intergenic
1119264237 14:73254712-73254734 CAGGGTCAGGCAGCAGGTGTGGG - Intronic
1119896260 14:78222264-78222286 CAGGGCCAGAGAGCAGCTGCTGG + Intergenic
1119968190 14:78940368-78940390 CAGGGAAAGAGAGAAGCTATTGG - Intronic
1120663093 14:87274059-87274081 CAGGGATATACAGCAGATGTTGG + Intergenic
1120693732 14:87621340-87621362 CAGCTCATGAAAGCAGCTGTGGG - Intergenic
1121328168 14:93033913-93033935 CAGGACTGCACAGCAGCTGTGGG + Intronic
1121840783 14:97132089-97132111 GAGGGCAAGACCCCAGCTGGAGG - Intergenic
1122692038 14:103536077-103536099 CTGGCCTAGACAGCAGCTGGGGG - Exonic
1122757958 14:103997562-103997584 CAGGGCCAGGGAGCAGCTGGCGG + Intronic
1123148316 14:106155991-106156013 CAGGGCAGGGCAGCAGATCTGGG + Intergenic
1123448622 15:20346518-20346540 CAGGGCAGGCTGGCAGCTGTAGG + Intergenic
1123948855 15:25251880-25251902 CAGGGCAACCAAGCAGCTGATGG - Intergenic
1124204438 15:27704871-27704893 CAGGACAAGACAGCCCCTGGTGG + Intergenic
1124433847 15:29631818-29631840 CAGGGCCAGGTGGCAGCTGTTGG - Intergenic
1124604443 15:31160334-31160356 CAGGACTAGGCACCAGCTGTGGG - Intronic
1126929558 15:53632628-53632650 CAGCCCATGAGAGCAGCTGTGGG + Intronic
1129120947 15:73396230-73396252 CAGGACAAGATGGCAGGTGTGGG - Intergenic
1130726776 15:86447367-86447389 CAGGGAAAGCCTGAAGCTGTTGG + Intronic
1131873613 15:96783291-96783313 CTGGGGAAGGCAGCAGCTCTGGG - Intergenic
1132573137 16:652721-652743 CAGGAGGTGACAGCAGCTGTGGG - Intronic
1134090665 16:11390175-11390197 CAGCCCAAGACAGCATCTGTTGG + Exonic
1134654919 16:15941016-15941038 CAGAGCAACTGAGCAGCTGTGGG - Intergenic
1136681894 16:31971650-31971672 CAGGGCAGGGCAGCAGATCTGGG - Intergenic
1136782203 16:32913152-32913174 CAGGGCAGGGCAGCAGATCTGGG - Intergenic
1136887585 16:33940700-33940722 CAGGGCAGGGCAGCAGATCTGGG + Intergenic
1137960621 16:52878362-52878384 CAGGGAAAGACAGCTTTTGTAGG - Intergenic
1138153182 16:54678340-54678362 AAGGGAGAGAGAGCAGCTGTGGG + Intergenic
1138438921 16:57022702-57022724 CCGCTGAAGACAGCAGCTGTGGG - Intronic
1139255379 16:65536105-65536127 CAGGTGAAGACAGGAGTTGTGGG - Intergenic
1140191466 16:72820639-72820661 CAGGGGAAGACAGCATATTTTGG - Intronic
1140209816 16:72961115-72961137 CAGGGCCAGATAGAAGCTGCTGG - Intronic
1140467809 16:75196367-75196389 CAGGGCAGGCCCCCAGCTGTCGG + Intergenic
1141642195 16:85347834-85347856 CAGGGACAGACAGCAGCTCCTGG + Intergenic
1142001719 16:87668113-87668135 CAGGGCAAGACACCAAAAGTTGG - Intronic
1142240745 16:88943758-88943780 CAGGGCAAGAAACCAGTTCTTGG - Intronic
1142439460 16:90086123-90086145 CAGCCCATGAGAGCAGCTGTGGG + Intronic
1203084864 16_KI270728v1_random:1177138-1177160 CAGGGCAGGGCAGCAGATCTGGG - Intergenic
1142690802 17:1605292-1605314 GAGGGGAAAACAGCAGCTGCAGG + Intronic
1143405980 17:6677469-6677491 CAGGGCAAGCCTGAAGCTGCGGG + Intergenic
1143658908 17:8312915-8312937 CAGGCCAGGCCAGCATCTGTGGG - Exonic
1144018565 17:11220403-11220425 CAGGGCCAGGGAACAGCTGTGGG - Intergenic
1144064507 17:11612435-11612457 CAGTGCAAAGCAGCAGCTGTAGG - Intronic
1144741091 17:17582639-17582661 CAGGGCATGAGGGCAGCTCTGGG - Intronic
1144803403 17:17947516-17947538 CACAGCAAGACAGTAGCTGTTGG + Intronic
1144832575 17:18139888-18139910 CAGGGCAAGGCCACAGCTGGTGG - Intronic
1145211029 17:21013164-21013186 CTTGGCAAGACTGAAGCTGTGGG - Intronic
1146702507 17:34973560-34973582 AAGATCAAGACAGGAGCTGTAGG + Intronic
1147188450 17:38725462-38725484 TAGGCCAAGAAAGCTGCTGTGGG - Intronic
1147239382 17:39080552-39080574 CAGGGACTGACTGCAGCTGTTGG + Intronic
1147566622 17:41540412-41540434 CTGAGCAGGACACCAGCTGTGGG - Intergenic
1149213939 17:54332364-54332386 CAGGACACCACAACAGCTGTTGG - Intergenic
1149369392 17:55978188-55978210 CAGCTCATGACAGCAGCTGTGGG - Intergenic
1149599734 17:57885631-57885653 CAGGGCAAGTAAGCGGCTGACGG - Exonic
1152301325 17:79496634-79496656 CAGGGACAGACAGCAGCAGAGGG + Intronic
1152344690 17:79743833-79743855 CAGGGCCACAGAGCAGGTGTTGG - Intergenic
1152514664 17:80816333-80816355 CAGGACCAGAGAGCAGCTGAGGG + Intronic
1152699666 17:81812708-81812730 CAGGGCCAGAGGGCAGCTGGGGG + Intronic
1152958111 18:57533-57555 CAGCCCATGAGAGCAGCTGTGGG - Intronic
1155170300 18:23262299-23262321 CAGTGCATCACAGCAGCTGCTGG + Intronic
1155707786 18:28837933-28837955 CAGCCCATGAAAGCAGCTGTGGG - Intergenic
1155798826 18:30074249-30074271 CAAGCCATGAGAGCAGCTGTAGG + Intergenic
1156355024 18:36333286-36333308 CAGGTAAAGACAGCTGCTGCTGG + Intronic
1156750517 18:40447980-40448002 TAGGGCAATGCAGCAGCTCTAGG + Intergenic
1157318513 18:46615294-46615316 CAGGGCAAGACTGCAGACCTGGG - Intronic
1159149735 18:64505557-64505579 CAGTGCATGAGAGCAGCTATGGG + Intergenic
1159651774 18:70986581-70986603 CAGCCCATGAAAGCAGCTGTGGG + Intergenic
1160722790 19:604713-604735 CAGGGCCAGACATCAGGGGTGGG + Intronic
1160982016 19:1820545-1820567 CAAGGCAAGACAGGAGCAGCAGG + Intronic
1161398904 19:4059071-4059093 CAGGGCCAGACGGCAGATGGTGG - Intronic
1161645850 19:5452950-5452972 GAGGACAAGACAACAGATGTTGG - Intergenic
1162024009 19:7883467-7883489 CAGGGACAGACAGGAGCTGGTGG + Intergenic
1162322687 19:9979220-9979242 CAGGGAAAGACAGGAGAAGTGGG - Exonic
1164467586 19:28500884-28500906 GAGGGGAAGACAGCAGCAGAAGG - Intergenic
1165247971 19:34508607-34508629 CAGGGCAAGGAAGCAGCTAAGGG - Exonic
1165342397 19:35222447-35222469 TAGGCCAGGATAGCAGCTGTGGG - Intergenic
1165811134 19:38612564-38612586 CAGGGCTAGACAGGATCTCTGGG + Intronic
1166203515 19:41253792-41253814 CAGGGCTAGACACCCGCTGAGGG + Intronic
1166368485 19:42289174-42289196 CAGGGCCAGACACCATCTGCAGG - Exonic
1168003261 19:53466044-53466066 CAGGGAAAGACAGAAGCTTTAGG - Intergenic
1168346508 19:55652643-55652665 CAGGGCCAGAAAGCAGCGGCGGG - Exonic
925011073 2:486728-486750 CAGGGCCACACAGCACCTGTTGG - Intergenic
925194640 2:1913284-1913306 CAGGACAAGCCAGGAACTGTGGG - Intronic
925367340 2:3319767-3319789 CAGGGCAATACTGCACCTGCGGG + Intronic
925367354 2:3319826-3319848 CAGGGCAATACTGCACCTGTGGG + Intronic
925367377 2:3319921-3319943 CAGGGCAATACTGCACCTGCGGG + Intronic
926706845 2:15843246-15843268 CGGGACCAGACAGCCGCTGTGGG + Intergenic
927302879 2:21536209-21536231 CAGCCCATGAAAGCAGCTGTGGG + Intergenic
927515556 2:23669803-23669825 CAGCGCAGGACAGCAACTCTTGG + Intronic
931260115 2:60610442-60610464 CAAGGAAATACAGCAGCAGTTGG - Intergenic
932648475 2:73530495-73530517 CAGCTCATGACAGTAGCTGTGGG - Intronic
932923349 2:75942250-75942272 CAGCCCATGAAAGCAGCTGTGGG + Intergenic
933985862 2:87591709-87591731 CAGTCCATGAGAGCAGCTGTGGG + Intergenic
934087502 2:88522397-88522419 AAGGGCATGACAGCAGCTTCTGG + Intergenic
934122416 2:88853173-88853195 CAGAGCCAGACATCAACTGTGGG - Intergenic
934124474 2:88873456-88873478 CAGAGCTAGACAGCTGCTGCAGG - Intergenic
934911157 2:98255587-98255609 CACCGCCAGCCAGCAGCTGTGGG + Intronic
935690848 2:105731268-105731290 CAGGGCAAGGCAGGAGCACTAGG - Intergenic
935897586 2:107754202-107754224 CAGGGCAACAGAACAGCTGATGG - Intergenic
936307977 2:111359095-111359117 CAGTCCATGAGAGCAGCTGTGGG - Intergenic
937216369 2:120316130-120316152 TGGGGCCACACAGCAGCTGTGGG - Intergenic
937262982 2:120598197-120598219 CAGGCCAAGACAGACGCAGTGGG - Intergenic
937326746 2:120993993-120994015 GAGGGCAAGCCAGCAGCTGCAGG + Intergenic
937380796 2:121374572-121374594 CAGTCCATGAAAGCAGCTGTAGG + Intronic
937906950 2:127057055-127057077 GAGGGGCTGACAGCAGCTGTGGG + Intronic
939437045 2:142190894-142190916 CAATGCAAGACATCAGCTCTAGG + Intergenic
940121883 2:150276578-150276600 CAGCTCATGACAGCAGCTGTGGG - Intergenic
943248396 2:185485116-185485138 CAGCCCATGAAAGCAGCTGTTGG + Intergenic
943268892 2:185772502-185772524 CATGGTAAGAAAGCAGCAGTGGG + Intronic
943688614 2:190845514-190845536 AAGGGGAAGACAGAAGCTGAAGG - Intergenic
945222169 2:207495470-207495492 CAGAGAAAGACAGGAGCTGAAGG + Intergenic
948302084 2:236915033-236915055 CAGGGCAGGACTGCAGCCGAGGG + Intergenic
948825271 2:240570858-240570880 CAGGGCAAGTGGGGAGCTGTGGG + Intronic
948929711 2:241124174-241124196 CCTGGCTAGACAGCAGCTTTAGG + Intronic
1168820710 20:771919-771941 CAGGTCAAGACAGCAGACGAAGG + Intergenic
1169592884 20:7164378-7164400 CAGCCCATGACTGCAGCTGTGGG + Intergenic
1171132102 20:22663495-22663517 CAGGGGAATAAAGCTGCTGTTGG - Intergenic
1171818677 20:29812525-29812547 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1171899124 20:30840500-30840522 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
1173004748 20:39131368-39131390 TAGGGAAAGACAGCGGGTGTTGG + Intergenic
1173370020 20:42426876-42426898 CAGGGGAAGCCAGCAGGTGATGG + Intronic
1173380942 20:42540539-42540561 CAGAGCAAGCCAGCAGCTCTGGG + Intronic
1173975384 20:47183053-47183075 CAGGGCAACACAGCAGGAGGAGG - Intronic
1174270350 20:49363965-49363987 CAAGACAAGACAGCAGCTGGAGG + Exonic
1174339829 20:49888711-49888733 CAAATCAAGACAGCAGTTGTGGG - Exonic
1174455458 20:50645621-50645643 CAGGGATGGACAGCAGCTGGAGG - Intronic
1174858221 20:54066660-54066682 CACAGCAAGAAGGCAGCTGTTGG + Intronic
1175861627 20:62153375-62153397 AAGGGCAAGACAGCGCCTCTGGG - Intronic
1179101298 21:38357437-38357459 CAGGGAAGGACATCAGCTGGCGG + Intergenic
1180322122 22:11331899-11331921 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1180332791 22:11547803-11547825 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
1180948506 22:19709736-19709758 CAGGCAGAGACAGCTGCTGTGGG + Intergenic
1180952830 22:19728449-19728471 CTGGGGAAGGCAGCAGCTGTGGG - Intergenic
1181301760 22:21885268-21885290 CAGAGCAAGACACCAGCTCAGGG + Intergenic
1181335568 22:22125549-22125571 CAGGGAACCACAGCAGATGTGGG - Intergenic
1182466747 22:30521540-30521562 CAGGGGAAGGCAGCTGCTATTGG - Intergenic
1182568587 22:31218696-31218718 AAGGGCAGGGCAGCAGCTGCTGG - Intronic
1182658423 22:31907755-31907777 CAGGGCAGTTCAGGAGCTGTGGG + Intergenic
950004729 3:9684463-9684485 CTGGGGAAGACAGAAGCTGGTGG + Intronic
950126864 3:10514914-10514936 TTGGGCAAGACAGCCGCAGTGGG + Intronic
950512975 3:13444144-13444166 CAGGTCAAGATAGCATCTCTGGG + Intergenic
950572468 3:13809986-13810008 CAGGGAGAGACAGGAGCTGGTGG + Intergenic
951143603 3:19198398-19198420 CAGTGCAAGACAACCGCAGTGGG + Intronic
954118053 3:48478148-48478170 CAGGGCAGGACAGCCGCTCCTGG + Intronic
956346655 3:68286975-68286997 AAGGGAAACACAGCAGTTGTGGG + Intronic
956572494 3:70712425-70712447 CAGCCCATGAAAGCAGCTGTGGG - Intergenic
956640583 3:71412059-71412081 CAGGGAGAGACAGGTGCTGTAGG - Intronic
956728599 3:72176987-72177009 CAGGCAAAGCCAGCAGTTGTTGG + Intergenic
957087820 3:75698923-75698945 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
957711365 3:83863505-83863527 TATGGCAAGAGAGCAGCTGTGGG + Intergenic
961499340 3:127320730-127320752 CTGGCCATGACATCAGCTGTGGG + Intergenic
961501055 3:127336374-127336396 GAGGGCATGAAAGCGGCTGTGGG - Intergenic
964059023 3:152498412-152498434 CTGGACAAGACAGCAGAAGTAGG + Intergenic
967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG + Intergenic
968435684 4:587681-587703 CAGGGCAAGGCAGCAGGGATAGG - Intergenic
968758576 4:2429174-2429196 CAGGCCAAGACAGCATCAGGGGG - Intronic
970586843 4:17522742-17522764 GAGGGCAAGACAGCAAGCGTGGG - Intronic
971396933 4:26237103-26237125 CAGGGCCAACCAGCTGCTGTTGG - Intronic
971545421 4:27879762-27879784 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
972693781 4:41424821-41424843 CTGGGCCAGACAGCAGCTATTGG + Intronic
972902409 4:43700907-43700929 CATAGCAAGACAGCACCGGTTGG - Intergenic
973532991 4:51851539-51851561 CAGGGCTAGGCAGGAGCTGGTGG + Intronic
974018877 4:56675634-56675656 CAGTGCAATACAGCAGATGCAGG - Intronic
974657959 4:64849337-64849359 CAGTGCAAGACAGTACCTGACGG - Intergenic
976000730 4:80370768-80370790 CAGCACATGAGAGCAGCTGTGGG - Intronic
977378368 4:96237708-96237730 CAGCTCATGAGAGCAGCTGTGGG + Intergenic
978344609 4:107754015-107754037 CATGGCAAGGCAGGAGCTGAAGG + Intergenic
980894125 4:138845249-138845271 AAGCGCAAGTCAGCAGCTGCTGG + Intergenic
981103927 4:140859157-140859179 CATGGCCAGGCAGGAGCTGTGGG - Intergenic
982682143 4:158444108-158444130 CAGGGTAACACAGTAACTGTAGG - Intronic
983868040 4:172791225-172791247 GAGGGCAAGACACAAGATGTGGG + Intronic
985474596 5:72595-72617 CACCACCAGACAGCAGCTGTGGG - Intergenic
988454192 5:31372996-31373018 GGGGGCAAGACAGAAGCTGGGGG - Intergenic
989398391 5:40982771-40982793 CAAAACAAAACAGCAGCTGTGGG + Exonic
990189382 5:53241527-53241549 GAGGTCAAGACAGCAACTGCTGG - Intergenic
990712165 5:58595413-58595435 CTGGTGAAGACAGCAGCTGGTGG + Intronic
991450090 5:66742513-66742535 AAGGCCAAGGCAGCAGCTGGAGG - Intronic
991671550 5:69053356-69053378 CAGGGCAAGACTGCATCTCGGGG + Intergenic
992260563 5:74966164-74966186 CAGAGGCAGACAGCAGCTCTGGG + Intergenic
995738521 5:115329517-115329539 AAGGGCAAGAGGACAGCTGTGGG - Intergenic
996232855 5:121087746-121087768 CAGCCCATGAAAGCAGCTGTGGG - Intergenic
996820586 5:127622126-127622148 CAGGGCAAAGCACCAGCTGGAGG + Intergenic
997309853 5:132870703-132870725 GAAGGAAAGACAGCTGCTGTGGG + Intergenic
999387986 5:151169078-151169100 CAGGGCTGGACGGCAGCTGGAGG - Intergenic
999935323 5:156479949-156479971 CAGGGCAAGACAGCAGCTGTTGG - Intronic
1001302006 5:170540436-170540458 CAGGGCTGGGCAACAGCTGTTGG - Intronic
1001667747 5:173447280-173447302 TAGGGCAAGATGGCAGCTGCTGG - Intergenic
1002391474 5:178916042-178916064 CAGGGCAAAACAGCAAAGGTGGG + Intronic
1003136685 6:3439766-3439788 CAGGCCAGGACAGCAGGGGTGGG + Intronic
1003233299 6:4273860-4273882 GAGGGCAAGACAGCAGCAGAGGG - Intergenic
1003817907 6:9862578-9862600 CAGGCCATGAAAGCAGCTGTGGG - Intronic
1004589016 6:17030832-17030854 CAGGGCCAGCCAGCTACTGTGGG + Intergenic
1006180347 6:32150397-32150419 CAGTGCAAGGCTGCAGCTGCAGG + Exonic
1008132070 6:47729895-47729917 CAGGGCTGGACAGCAGCAGCAGG - Intergenic
1009865774 6:69395912-69395934 CAGGGCAAGCCAGCAGCTGGAGG - Intergenic
1011436600 6:87344676-87344698 CAGAGTAAGACAGCAGCAATAGG + Intronic
1011616949 6:89206086-89206108 GAGGGCGAGACAGCAGGGGTGGG - Intronic
1011934049 6:92753399-92753421 CAGGTTCTGACAGCAGCTGTGGG + Intergenic
1013088320 6:106875591-106875613 CAGCTCATGAGAGCAGCTGTAGG - Intergenic
1015552186 6:134423185-134423207 CAGGGCAAGGCTGATGCTGTTGG + Intergenic
1016017951 6:139205189-139205211 CAGGGCATTACAGCAACTCTTGG + Intergenic
1016829707 6:148421708-148421730 CAGGGCAAGAGTGCTGCTGGTGG - Intronic
1017706961 6:157132411-157132433 CAGCGCAAGCCTGCAGTTGTTGG + Intronic
1019164550 6:170089275-170089297 CAGGGGAAGCCAGCAGCAGGAGG - Intergenic
1019434548 7:1015295-1015317 CCGGGCATGAGAGCAGGTGTGGG + Intronic
1021587255 7:22222568-22222590 CAGGGCTAGAAAAGAGCTGTAGG + Intronic
1022182987 7:27940009-27940031 CAGGGCCAGACTGCAGGTGTTGG + Intronic
1023205732 7:37747554-37747576 AAGGGCAAGAGAGAGGCTGTAGG + Intronic
1026578664 7:71595934-71595956 AAGGGCAAGAGAGTAGATGTTGG + Intronic
1026894854 7:74004062-74004084 CAGTGCTAGGCAGCAGCTTTTGG + Intergenic
1027783041 7:82543533-82543555 CAGGGCTAGATAGCTCCTGTTGG + Intergenic
1030357271 7:108556660-108556682 CAGCCCATGAAAGCAGCTGTGGG - Intronic
1031806774 7:126316796-126316818 CAGCCCATGAAAGCAGCTGTAGG - Intergenic
1032703643 7:134403808-134403830 CAGGGTAAGGCAGCTGCTGTGGG + Intergenic
1034893350 7:154859317-154859339 CAGGGCAAGACAGGAGGCCTCGG + Intronic
1035472473 7:159119240-159119262 CAGGGGCAGCCAGGAGCTGTGGG - Intronic
1035632241 8:1116934-1116956 CAGAGGAAGCCAGTAGCTGTTGG - Intergenic
1036031355 8:4977619-4977641 TGGGGTAAGGCAGCAGCTGTGGG - Intronic
1037858474 8:22388419-22388441 CAGGGCAAGAGAGCAGTGGCAGG + Intronic
1037893424 8:22636266-22636288 CAGGACAGTACAGCAGCTGGTGG - Intronic
1037967750 8:23146942-23146964 CAGGGTAAGACAGCAGCCAGGGG - Exonic
1040634365 8:49254928-49254950 CAGGGGAAGACATCACATGTTGG - Intergenic
1040863513 8:52024499-52024521 CAGCACGTGACAGCAGCTGTGGG + Intergenic
1042043922 8:64626203-64626225 AGGGGCCAGAGAGCAGCTGTGGG - Intronic
1042585395 8:70332719-70332741 CAGGCCAAGAAAGCAAGTGTTGG - Intronic
1042845196 8:73162988-73163010 CAGAGGCAGACAGCAGCTGGTGG - Intergenic
1043204990 8:77426613-77426635 CAGCCCATGAAAGCAGCTGTGGG + Intergenic
1045193465 8:99906244-99906266 AAGGGCCAGATAGTAGCTGTGGG + Intergenic
1045312869 8:101018436-101018458 CAGAGCAAGAGAACAGCTCTGGG - Intergenic
1045333864 8:101180727-101180749 AAGGGGAAGACAGCAGGAGTAGG - Intronic
1045571732 8:103374658-103374680 CAGTGCAAGGCAGCAACTCTGGG - Intronic
1046818812 8:118614759-118614781 CAGGACAGGACAGCAGCTGTTGG - Intronic
1047521617 8:125599399-125599421 CAGGGCAGGACAGATGCTGGTGG - Intergenic
1047685677 8:127302721-127302743 CAGGGCAAGTCAGAAGATGTGGG - Intergenic
1048847758 8:138616293-138616315 CAGGGAAGAACAGCAGCTGAAGG + Intronic
1049339206 8:142102963-142102985 CAAGTGGAGACAGCAGCTGTGGG - Intergenic
1049427824 8:142545141-142545163 CAGGGCAAAGCAGGAGCTGCAGG - Intergenic
1051137964 9:13944570-13944592 CTGGGCAGGGCAGCAGCTGATGG - Intergenic
1052540358 9:29803907-29803929 CAGGGAAAAAAAGCAGCAGTGGG - Intergenic
1053293449 9:36897172-36897194 CGGGTCCAGGCAGCAGCTGTGGG + Intronic
1053598154 9:39584829-39584851 CAGGGCAGGACAGCAGAACTAGG + Intergenic
1053856181 9:42341837-42341859 CAGGGCAGGACAGCAGAACTAGG + Intergenic
1054897293 9:70328597-70328619 CAGCCCATGAAAGCAGCTGTGGG - Intronic
1055601631 9:77925086-77925108 CAAGGCAAGGGAGCAGTTGTTGG - Intronic
1055723837 9:79206162-79206184 CATGGCAGGCCAGCAGGTGTTGG - Intergenic
1056894901 9:90536092-90536114 CAGGGGAAGACATCACATGTCGG + Intergenic
1056946563 9:91002657-91002679 CAGTGAAAGACAGAAGCTGTAGG + Intergenic
1057024383 9:91724351-91724373 CGGGGCAAGGCAGCACCTGCCGG + Exonic
1057035636 9:91810073-91810095 CAGGGCAAGACAGCAGGCACAGG + Intronic
1057276750 9:93680262-93680284 CAGGGCAAGACCCCATGTGTGGG - Intergenic
1057354171 9:94321286-94321308 CAGGACCAGGCAGCAGCTGAGGG + Intronic
1059148362 9:111922589-111922611 AATGGCAAGACTGCAGTTGTGGG + Intronic
1060007723 9:120015257-120015279 AAGGGCAAGGCAGCAGATGGGGG + Intergenic
1060346850 9:122824360-122824382 GAGAGCAAGAGAGGAGCTGTTGG - Intronic
1060828054 9:126697501-126697523 CAGGACAGCACAGCTGCTGTGGG - Exonic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061282350 9:129604611-129604633 TAGGGCAGGAGAGAAGCTGTGGG + Intergenic
1062740053 9:138167068-138167090 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
1203370333 Un_KI270442v1:297791-297813 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1187308479 X:18118699-18118721 CAGGGCAAGCCAGCAGTGGTGGG + Intergenic
1190502267 X:51091211-51091233 TATGGGAAGACAGCAACTGTAGG + Intergenic
1190934549 X:54984962-54984984 CTGGGCGAGACAGCAGCTTCTGG - Intronic
1194489680 X:94530741-94530763 CAGCCCAACACACCAGCTGTGGG + Intergenic
1195119581 X:101736763-101736785 GAAGGGAAGACATCAGCTGTGGG + Intergenic
1196058506 X:111382663-111382685 GAGTGCAAGACAGGATCTGTTGG + Intronic
1198400139 X:136260878-136260900 CAGGGTAAGACAGCACTTGGGGG + Intergenic
1198873787 X:141202171-141202193 CAGCCCAGGAAAGCAGCTGTCGG + Intergenic
1199745341 X:150768936-150768958 CAGAGCAGCACAGCAGCTGCGGG + Exonic
1199867120 X:151861814-151861836 CAGGGCAAGACTGAAGCAGAGGG - Intergenic
1200395886 X:155987469-155987491 CAGCCCATGAAAGCAGCTGTGGG + Intergenic