ID: 999935392

View in Genome Browser
Species Human (GRCh38)
Location 5:156480596-156480618
Sequence CTGCTACCCCAGATGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999935389_999935392 10 Left 999935389 5:156480563-156480585 CCTTGACACTGGTGGTAGAGTCA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 999935392 5:156480596-156480618 CTGCTACCCCAGATGGCACATGG 0: 1
1: 0
2: 3
3: 26
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999935392 Original CRISPR CTGCTACCCCAGATGGCACA TGG Intronic
900207496 1:1437887-1437909 CTGCCCCCCCAGAGAGCACAGGG + Intronic
900394809 1:2448887-2448909 CTGCTGCCCCGGAAGGCACCTGG + Intronic
900429665 1:2595712-2595734 CCGCTACCCCCGCTGGCTCATGG + Intronic
900506242 1:3030999-3031021 CTGCTATCCCCGCTGGCCCAGGG + Intergenic
901063348 1:6483963-6483985 CTGCCGCCCCAGCTGGCACTAGG - Intronic
901648241 1:10728067-10728089 CTCCTTCCCCACATGGCACTGGG + Intronic
901847931 1:11996344-11996366 TTGCTCCCCCAGCAGGCACAGGG - Intronic
901895709 1:12310242-12310264 CAGCAACCCGAGATGGCACTTGG + Intronic
903130587 1:21277114-21277136 CTGCTTTCCCAGGTGGCTCAGGG + Intronic
904390919 1:30185303-30185325 CAGATGCCACAGATGGCACAAGG - Intergenic
905017091 1:34785380-34785402 CTGCTACCTCATCTGCCACAGGG + Exonic
905107091 1:35570428-35570450 CAGGTATCCCAGAGGGCACATGG - Intergenic
906041824 1:42793581-42793603 CTCCTGCCCCAGACGGCCCAAGG - Intronic
909568288 1:77080159-77080181 CTGCTACACCAGATGACATAAGG + Intergenic
912081320 1:105940674-105940696 ATTCAACCCCAGATGGCTCAAGG - Intergenic
914348537 1:146820274-146820296 ATGCTACCTTACATGGCACAGGG - Intergenic
916598718 1:166271882-166271904 CTGTAACCTCAGATGGCAGAAGG + Intergenic
916816982 1:168363683-168363705 CTGCAACCTCACATGGCAGAAGG - Intergenic
918102004 1:181384473-181384495 CTGCTACCCTACATGGAAAAAGG - Intergenic
920049063 1:203152345-203152367 CCGCCAGCCCAGCTGGCACATGG - Intronic
920411185 1:205762183-205762205 CTGCTTCCTCACATGGCAGAAGG - Intergenic
921998982 1:221454707-221454729 CTGTTGCTCCAGATGACACAGGG - Intergenic
922616150 1:226962288-226962310 CTCCTCCCCTAGATGGCACAGGG - Intronic
1063600063 10:7473086-7473108 CTGTTACCTTAGATGGCAAAGGG - Intergenic
1064396321 10:14984791-14984813 ATGTTACCCCTGATGTCACACGG + Intronic
1065133668 10:22647221-22647243 TTGCTACCAAAAATGGCACATGG - Intronic
1065485088 10:26229488-26229510 GCGCTACCCCAGAGGGCACATGG - Intronic
1067141670 10:43663058-43663080 CTGCTTCCCCTCATGGCAGAAGG + Intergenic
1067683522 10:48454516-48454538 CTGCAGCCCCAGGTGGCTCAGGG - Intronic
1067708311 10:48627539-48627561 CTGCTAGCCCAGATGGGAATGGG - Intronic
1068283285 10:54904798-54904820 GTGGTACCTCAAATGGCACATGG - Intronic
1069183537 10:65393410-65393432 CTGCAACCTCACATGGCAGAGGG + Intergenic
1069843661 10:71355818-71355840 CTGCTGCCTGAGGTGGCACATGG - Intronic
1070767854 10:79067012-79067034 CTGCTTCCCCGGTTGGCCCAAGG + Intergenic
1073419722 10:103414867-103414889 CTGTTATTCCAGATGGCACATGG - Intronic
1074409576 10:113214669-113214691 CTGCTACCGCTCATGGCAGAAGG - Intergenic
1075781261 10:125018698-125018720 CACCTACCCCAGGTGGCCCATGG - Intronic
1076114230 10:127884332-127884354 CAATTACCCCAGATGCCACAGGG - Intronic
1077155929 11:1090765-1090787 CTGCTACCCCCGGTGCCCCAAGG + Intergenic
1077798670 11:5516808-5516830 CTCCTTCCCCAGCTGGCCCAGGG - Intronic
1079125123 11:17713575-17713597 ATTCTTCCCCAGATGCCACATGG + Intergenic
1081976061 11:47235507-47235529 CTGCCACCCCAGATCGCTCCTGG + Intronic
1084836940 11:71809147-71809169 CTGCAACACCAGATGGCAGAAGG - Intergenic
1086918174 11:92555447-92555469 CTGTTATCCCAGAGGGCACTTGG - Intronic
1087037798 11:93772383-93772405 CTGCTTCCCCAGCTGGCATTGGG + Intronic
1091016477 11:132055507-132055529 CTGCCACTCCTGATGCCACAGGG - Intronic
1092402292 12:8186957-8186979 CTGCAACACCAAATGGCAGAAGG + Intronic
1092754872 12:11753745-11753767 CTTCTGCCCCAGAGGGCAGACGG + Intronic
1093193300 12:16100369-16100391 CTCCTACCCCATATGCAACAGGG + Intergenic
1093696723 12:22169488-22169510 CTGCTTCCACACATGGCAGAAGG + Intronic
1096072339 12:48782368-48782390 CCTCTACCCCAGATCCCACATGG + Intronic
1098759070 12:74401247-74401269 CTACTACCCAGGCTGGCACAGGG - Intergenic
1098802893 12:74984919-74984941 CAGCTTCCACAGATGGCACTAGG + Intergenic
1099927482 12:89035299-89035321 ATGCTATCTCAGATGGCAAAGGG + Intergenic
1100403183 12:94250051-94250073 GTTCTACCCCAGATAGCCCATGG - Intronic
1101263789 12:103063591-103063613 CTGTTGCCTCAGGTGGCACAGGG - Intergenic
1102008206 12:109602129-109602151 GTGCTGCCCCAGATGCCACGTGG - Intergenic
1103956379 12:124579184-124579206 CTGCTACCTTACATGGCAAAGGG - Intergenic
1104305790 12:127610101-127610123 CTGCTACCAAAAATGTCACAAGG + Intergenic
1105265194 13:18809041-18809063 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
1105620897 13:22065135-22065157 CTCCTTCCCCAGGGGGCACATGG - Intergenic
1107529788 13:41272284-41272306 TTGGTACCGCAGATGGCAAAGGG + Intergenic
1108069037 13:46608377-46608399 ATGTTACCCCAAATGACACATGG - Intronic
1108310477 13:49184701-49184723 CTGCTACCACAAATGTCACAAGG - Intronic
1108477046 13:50830757-50830779 ATGTTACCCCACATGGCACAGGG + Intronic
1109525331 13:63567132-63567154 CAGCTCCCACAGATGGCACTGGG - Intergenic
1110054618 13:70951131-70951153 CTGCTAGCCTAGATGGTACATGG - Intergenic
1110810766 13:79808554-79808576 CAGCTTCCCCAGCTGGCACTGGG - Intergenic
1114600984 14:23955163-23955185 CGCCTTCCCCACATGGCACACGG - Exonic
1114774174 14:25461962-25461984 CAGCTCCCCCAAGTGGCACAGGG + Intergenic
1115991689 14:39156730-39156752 CTGCCACCCAAGATGCCAAAAGG + Intronic
1117413066 14:55468174-55468196 CTGGCACTCCAGAGGGCACAAGG + Intergenic
1118836260 14:69480180-69480202 CTCCTGCCCTAGATTGCACAAGG - Intergenic
1120095642 14:80384627-80384649 CAGATACCTCAGATGGCACTTGG - Intronic
1121429863 14:93879116-93879138 CTGCTAACCCAGGTGGCTCAGGG - Intergenic
1122491355 14:102117920-102117942 CAGCTTCCCCAGCTGGCACTGGG - Intronic
1122983652 14:105202552-105202574 CTGCTTCCCCAGATGGTCCTGGG + Intergenic
1123663786 15:22590061-22590083 CTGCTACTCCTGTGGGCACAGGG + Intergenic
1123775426 15:23574727-23574749 CAGCTTCCCAAGATTGCACAGGG - Intronic
1124317617 15:28684510-28684532 CTGCTACTCCTGTGGGCACAGGG + Intergenic
1124565828 15:30813000-30813022 CTGCTACTCCTGTGGGCACAGGG - Intergenic
1125241656 15:37582978-37583000 CAGCTACCACGGCTGGCACAGGG - Intergenic
1127422105 15:58816486-58816508 CTGCAGCCTCAGATGGCTCAAGG + Intronic
1128559053 15:68652505-68652527 CTGCTACCCCAACTGGCACCTGG + Intronic
1129767430 15:78179179-78179201 CTCCTACCCCAGCTGGCCCCTGG + Intronic
1131024707 15:89130402-89130424 CTGCTACCGGAAATGGCACTTGG + Intronic
1132155044 15:99489695-99489717 ATGTTACCCCACATGGCAAAAGG - Intergenic
1132337617 15:101058589-101058611 CTGCTGCCCCAGATTGCAGAAGG + Intronic
1132359431 15:101200590-101200612 CTGCACCCCCAGATGGGTCAGGG + Intronic
1133128990 16:3664673-3664695 CTCCTGCCCCAGGTGGCCCAGGG + Exonic
1135011345 16:18882308-18882330 CTGATTCCCCAGAGGCCACATGG + Exonic
1135318252 16:21469889-21469911 CTGATTCCCCAGAGGCCACATGG + Intergenic
1135326037 16:21526465-21526487 CTGAGCCCCCAGATGGCACCTGG - Intergenic
1135371145 16:21901684-21901706 CTGATTCCCCAGAGGCCACATGG + Intergenic
1135484908 16:22855627-22855649 CTGATACCCCAGAAGCCAGATGG - Intronic
1136328456 16:29551331-29551353 CTGATTCCCCAGAGGCCACATGG + Intergenic
1136443141 16:30291345-30291367 CTGATTCCCCAGAGGCCACATGG + Intergenic
1137675877 16:50303733-50303755 CCCCAACCGCAGATGGCACAGGG - Intronic
1139676665 16:68528654-68528676 CTGTTACCCCAGGTGTCAAATGG + Intergenic
1139889868 16:70243769-70243791 CTGATTCCCCAGAGGCCACATGG + Intergenic
1139985499 16:70895274-70895296 ATGCTACCTTACATGGCACAGGG + Intronic
1141198534 16:81879601-81879623 CTCCTACCCCAGATGACCCAGGG - Intronic
1141262936 16:82470142-82470164 CAGCATCCCCAGATGTCACATGG + Intergenic
1141444111 16:84047202-84047224 ATGTTACCCCACATGGCAAAAGG + Intergenic
1141496543 16:84414351-84414373 ATGCAACCCCAGTGGGCACAAGG - Intronic
1142039075 16:87881190-87881212 CTGAGCCCCCAGATGGCACCTGG - Intergenic
1142600490 17:1051346-1051368 CTGGGAACCCAGCTGGCACACGG + Intronic
1143333027 17:6151718-6151740 CTGAAACCCCAGTAGGCACACGG - Intergenic
1143963765 17:10741452-10741474 CTGCCACCCCAGAGGCCTCAGGG - Intergenic
1145976177 17:28985720-28985742 CTGCCACCCAACATGGAACATGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148098837 17:45074661-45074683 CTCCTCCCCCAGAAGGCAGATGG - Intronic
1150034976 17:61784808-61784830 CTGCTTCCACTGATGGCAAAAGG - Intronic
1150292489 17:63989478-63989500 CTGCTGCCGCTGATGTCACAGGG + Intergenic
1151115609 17:71731781-71731803 CTTCTACCCCGGATGCCCCATGG + Intergenic
1151583485 17:74993798-74993820 CTCCTTCTCCAGATGACACAGGG + Intronic
1151750501 17:76034608-76034630 CTGCCACCCCAGCTGGCCCTGGG + Intergenic
1152445000 17:80337328-80337350 CTGGTGCCCCGGCTGGCACATGG - Intronic
1154129852 18:11727301-11727323 CTGCTACCCCACAAGGCAGGTGG - Intronic
1154423201 18:14252503-14252525 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
1157192397 18:45592473-45592495 CTGCTTCCCAAGATGGGACTGGG - Intronic
1157711332 18:49851810-49851832 GTGCTTCACCAGCTGGCACACGG + Intronic
1158416912 18:57256848-57256870 CTGCTACCCCAGATGCTGCAGGG + Intergenic
1159308125 18:66672339-66672361 CTGCTTCTCCAGCTTGCACATGG + Intergenic
1160426039 18:78779991-78780013 ATGCACCCCCAGATGGCTCATGG + Intergenic
1160873723 19:1287915-1287937 CTGCTGCCCCACCTGCCACAGGG + Intronic
1163177761 19:15576389-15576411 CTCCTGCCCCAGATGCCCCAGGG - Intergenic
1163862669 19:19750334-19750356 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
1164474542 19:28565070-28565092 ATCCTACCCCACATGGCCCAGGG + Intergenic
1166274083 19:41739441-41739463 CTGCTTGACCAGATTGCACAGGG + Intronic
1167672044 19:50859086-50859108 CTGCTCCCCCAGGTGCCGCAGGG - Intronic
1167674789 19:50877499-50877521 CTGCTCCCCCAGGTGCCGCAGGG - Intronic
925574733 2:5349130-5349152 CTCCTTCTGCAGATGGCACATGG - Intergenic
926309646 2:11666236-11666258 CTGCTGCCCCAGAGGCCACAGGG + Intronic
927226286 2:20768370-20768392 CAGCTTCCCCAGCTGGCACCAGG - Intronic
927553188 2:24016464-24016486 CTCCCTCCCCAGATGGCACGGGG + Intronic
932168892 2:69535646-69535668 CTCTTTCCCCATATGGCACATGG - Intronic
934916530 2:98305004-98305026 CTGCTTCCACAGAGGCCACACGG + Intronic
936001536 2:108835895-108835917 CTGCATCCTCACATGGCACAGGG + Intronic
936086061 2:109470135-109470157 CAGCCACCCCAGAAGGGACAAGG - Intronic
936507392 2:113118236-113118258 CTGCTGCCCCAGCAGGCACTAGG - Intronic
938127389 2:128684481-128684503 CACCTACCCCAGGAGGCACAGGG - Intergenic
940871474 2:158864115-158864137 ATGCTACTCCAAATGTCACACGG - Intergenic
941722922 2:168831227-168831249 CTGTAACCTCAGATGGCAGAAGG + Intronic
941811074 2:169756632-169756654 CTGCTGCTCCAGAGGGCACGAGG + Intronic
942227441 2:173829699-173829721 CTGGTACTGCAGATGGCTCAGGG + Intergenic
943280726 2:185929498-185929520 CTGCCACCTCACATGGCAGAGGG - Intergenic
943449687 2:188032603-188032625 CTGCTACCACAAACGTCACAAGG + Intergenic
948858827 2:240743158-240743180 CTCCCACCCCAGAGGCCACAGGG + Intronic
1170616133 20:17953243-17953265 GTGCTGCCCTAGATGACACAGGG + Intronic
1171295062 20:24010128-24010150 CTGCTTCCTCACATGGCAAAGGG - Intergenic
1171886028 20:30652981-30653003 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
1172629476 20:36368242-36368264 CTGCTGCCCCAGATGGCTTGCGG + Intronic
1172900858 20:38333875-38333897 TTGCTAGCCCAAAAGGCACACGG + Intronic
1172938331 20:38637103-38637125 CTGCTGCTCCAGAAGGCACCAGG - Intronic
1173606359 20:44334565-44334587 CTGCTTCGCCAGCTGGCCCAGGG + Intergenic
1174513419 20:51073168-51073190 CAGCTGCCCCAAATGGCTCATGG + Intergenic
1175773962 20:61641447-61641469 CTGCTACCCCAGAGCCCTCAAGG + Intronic
1176307430 21:5131201-5131223 TTGCTGGCCCAGGTGGCACAAGG + Exonic
1177519485 21:22200405-22200427 CTGCTACTCCAGAAGGCACATGG - Intergenic
1178687588 21:34723539-34723561 CTCCTGCCCCAGAAGGCCCAGGG + Intergenic
1179726099 21:43341922-43341944 GTGCCACCACACATGGCACATGG - Intergenic
1179849630 21:44130829-44130851 TTGCTGGCCCAGGTGGCACAAGG - Exonic
1184508564 22:44918614-44918636 CTGCTGTCCCAGGTGGCTCACGG - Intronic
1184869324 22:47225342-47225364 CAGCTTCCCCAGCTGGCACCAGG + Intergenic
949264548 3:2141208-2141230 ATGCTACCTCACATGGCAAAAGG + Intronic
949602314 3:5613566-5613588 CTGGTTCCCCACATGGCAAAAGG - Intergenic
949973221 3:9429456-9429478 TTTCTACCCCAGATGTCAGAAGG - Intronic
950808235 3:15626854-15626876 CTGAGACTCTAGATGGCACAAGG + Intronic
951718891 3:25677605-25677627 CTGGTGCCCCATATGACACATGG - Intergenic
954007527 3:47603635-47603657 CTGCCATTCCAGATGGCAAAAGG - Intronic
955573633 3:60334290-60334312 CTGAGTCCCCAGTTGGCACAAGG + Intronic
961415385 3:126753009-126753031 CTGCTTCCCCAGCTGGCAGAGGG + Intronic
961902501 3:130226665-130226687 CTGCAACCTCACATGGCAGAAGG + Intergenic
964254947 3:154765912-154765934 CAGCTTCCCCAGAGGGCACCTGG + Intergenic
964634359 3:158843836-158843858 CTGCTTCCCCCGCTGGCAGATGG + Intergenic
965708331 3:171531978-171532000 CTGTTACCCCTTATGACACACGG - Intergenic
966396504 3:179509583-179509605 CTGCAAACCCAGGTGGGACAGGG - Intergenic
968544725 4:1192959-1192981 CTGCCACCTCATCTGGCACAGGG + Intronic
969778343 4:9376642-9376664 CTGCAACACCAGATGGCAGAAGG - Intergenic
971251233 4:24975086-24975108 CTGCAACCTCACATGGCATAAGG - Intronic
973369625 4:49234988-49235010 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
973391406 4:49560428-49560450 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
973701507 4:53541959-53541981 CAGCTGCTCCAGATGACACATGG + Intronic
974620008 4:64341786-64341808 CTGCTTCCCCAGCTGTCACCAGG - Intronic
975321428 4:73012746-73012768 TTGCTTCCCCAGCTGGCACCAGG - Intergenic
978229801 4:106385183-106385205 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
978249096 4:106609868-106609890 CAGCTGCACCAGATGGCCCATGG - Intergenic
979462965 4:121004100-121004122 CAGCTTCCCCAGCTGGCACCAGG - Intergenic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
982297854 4:153848318-153848340 CTGCTGCCTCAGGCGGCACAAGG - Intergenic
982405109 4:155010568-155010590 ATGCAACCCCAGATGTCACTTGG + Intergenic
984102029 4:175498790-175498812 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
991017189 5:61944958-61944980 GTGCTACCTCAAAGGGCACATGG - Intergenic
993738468 5:91506875-91506897 CTGTTACCCCATATGGCAAAGGG - Intergenic
994441521 5:99811906-99811928 TAGCTACGCCAGAAGGCACAAGG + Intergenic
999312308 5:150559302-150559324 GTGCCACCTCTGATGGCACAAGG + Intergenic
999935392 5:156480596-156480618 CTGCTACCCCAGATGGCACATGG + Intronic
1001409230 5:171498417-171498439 TTGCTACCCCTGATGCCACGGGG - Intergenic
1003063934 6:2886172-2886194 CTGCTTCCACTGATGGCAAAAGG + Intergenic
1004117760 6:12787814-12787836 CTGCTATTCCAGAGGGCACTTGG + Intronic
1005406169 6:25490165-25490187 CTGCTTTCCCTGAGGGCACAGGG - Intronic
1005520738 6:26598431-26598453 CTGCTCGCCCAGATGGCTCCTGG + Exonic
1006486911 6:34350308-34350330 CTGGTACCCCAGATGGCACCAGG + Intronic
1007697530 6:43743300-43743322 CTGCTACCCAAGCAGGCCCACGG + Intergenic
1007750557 6:44068332-44068354 CCGCTCCCCCAGCTGGCAGAAGG + Intergenic
1009856069 6:69265458-69265480 CAGCTTCCCCATATGGAACATGG - Intronic
1010265186 6:73857692-73857714 CTGCTGCCACAAGTGGCACATGG - Intergenic
1010498645 6:76567244-76567266 CAGCCACCCTAGGTGGCACAAGG + Intergenic
1012231079 6:96762070-96762092 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
1013115841 6:107103192-107103214 CTGCATCCCCAGCTGGCGCAGGG + Intronic
1017054606 6:150425634-150425656 CAGCTTCCCCTGATGGCACCGGG - Intergenic
1018472695 6:164110724-164110746 CTGCTGCTCCAGCTGTCACATGG - Intergenic
1021751200 7:23802271-23802293 CTGCTACCACAAATGTCACAAGG - Intronic
1022501310 7:30883776-30883798 CTGCTCCCCCAGAAGGGACCAGG - Intronic
1022663284 7:32386642-32386664 TTGCTAGCCCAAAAGGCACACGG + Intergenic
1023862341 7:44224278-44224300 CTGCCTCCCCACATAGCACATGG + Intronic
1024207165 7:47173659-47173681 CTGCCTCCCCTGTTGGCACATGG + Intergenic
1024486706 7:49927723-49927745 CTATTACCCCAGATGCTACAAGG + Intronic
1027154866 7:75759715-75759737 CTGCTTCCTCACATGGCAGAAGG - Intergenic
1027548376 7:79559016-79559038 CTCCTACCCCGTCTGGCACAAGG + Intergenic
1028479246 7:91286653-91286675 CTGCTGCCCCTGTTGGCACTGGG - Intergenic
1028874864 7:95810037-95810059 CTGATATCCCAGAAGGGACAAGG + Intronic
1033370117 7:140699557-140699579 CTGCAACCCCATATGGTAAAAGG - Intronic
1033508297 7:142028416-142028438 ATGCTAACCCAGATGGCTCATGG - Intronic
1034432440 7:151047930-151047952 CTGCCACCCCAGGTAGAACATGG - Intergenic
1035477775 7:159155803-159155825 CTTCTATTCCAGCTGGCACAGGG + Intergenic
1036156540 8:6347413-6347435 TTGAGAACCCAGATGGCACAGGG - Intergenic
1036275799 8:7350638-7350660 CTGAAACACCAGATGGCAGAAGG - Intergenic
1036345556 8:7959720-7959742 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036493253 8:9247182-9247204 ATGCTACCTCAAATGGCAAAAGG - Intergenic
1036840883 8:12120474-12120496 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036862690 8:12366724-12366746 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036907151 8:12716630-12716652 ATGTTACCCCTGATGTCACACGG + Intergenic
1037386044 8:18343068-18343090 CTGCCACCACAGAAGGCAAAAGG + Intergenic
1037645728 8:20791065-20791087 CAGCTGCCCCAGATGCCACAGGG + Intergenic
1038277018 8:26129973-26129995 CTGCCACTCCAGAGAGCACAGGG + Intergenic
1039402897 8:37286709-37286731 CTCCTTCCCCAGATGACACAAGG - Intergenic
1040013343 8:42680456-42680478 CTGGTATCCCACATGGCAGAGGG - Intergenic
1041535868 8:58925009-58925031 AAGCAGCCCCAGATGGCACATGG + Intronic
1042405203 8:68396813-68396835 CTGCTTCCCCTCATGGCAGAAGG - Intronic
1042526672 8:69771699-69771721 CTGCTGCCCCAGATGCCCCTCGG + Intronic
1042788947 8:72581961-72581983 CTTCTACCACTGATGGCAGATGG + Intronic
1043448264 8:80340474-80340496 CAGCTTCCCCAGATGGGGCAAGG + Intergenic
1043568006 8:81570124-81570146 CAGCTTCCCCAGCTGGCACCAGG + Intergenic
1043576213 8:81660609-81660631 CTGCTCCGCCAGTTGCCACAAGG + Exonic
1043963456 8:86445013-86445035 CTGCTTCCACTCATGGCACAAGG + Intronic
1044409660 8:91868966-91868988 CTGCTTCCCCAGCTGGCACAGGG - Intergenic
1047018834 8:120753067-120753089 TTGCTAAGCCTGATGGCACAGGG + Intronic
1048965067 8:139609206-139609228 CTGTTACCCCATATGCCAAATGG + Intronic
1049613557 8:143566952-143566974 CTCCTGGCCCAGATGGCACCTGG - Exonic
1052552448 9:29969133-29969155 CAGCTTCCCCAGCTGGCACCAGG + Intergenic
1052877081 9:33575377-33575399 CTGCAGCCCCAGATGGCACCTGG + Intergenic
1053449830 9:38184153-38184175 CTGCTTCCCCTCATGGCAGAAGG + Intergenic
1053498924 9:38569017-38569039 CTGCAGCCCCAGATGGCACCTGG - Intronic
1056514371 9:87336124-87336146 CTTCTAGCCCAGATGGAACATGG + Intergenic
1057678371 9:97153509-97153531 CTGCAGCCCCAGATGGCACCTGG - Intergenic
1057968310 9:99526489-99526511 GTGCTACTGCAGCTGGCACATGG - Intergenic
1060598492 9:124862209-124862231 CAGCTACCAGAGATGGCACACGG + Exonic
1061255338 9:129451907-129451929 CTGTTAGCCAAGATGGCCCAGGG + Intergenic
1186592617 X:10947103-10947125 CTGGCACCACAGTTGGCACATGG + Intergenic
1186805948 X:13140106-13140128 CAGCTTCCCCAGCTGGCACCAGG - Intergenic
1188280196 X:28258226-28258248 CTGCTACCCCAGATGGAGAGAGG + Intergenic
1189830841 X:44971739-44971761 CTGCTACCATAAATGTCACAAGG - Intronic
1190438246 X:50449172-50449194 CTGCCACCCTAAAGGGCACATGG - Intronic
1191754584 X:64580491-64580513 CTGCTACCATAAATGTCACAAGG - Intergenic
1193574928 X:83185345-83185367 CAGCTTCCCCAGCTGGCACCAGG + Intergenic
1195121235 X:101755124-101755146 CTGGTACCTCAGATGGTGCAGGG - Intergenic
1195540250 X:106055225-106055247 TTGGTACTCCAGATGGCAAACGG - Intergenic
1197042673 X:121958342-121958364 TTGGTACTCCAGATGGCAAAGGG - Intergenic
1198692915 X:139303561-139303583 CTGCCACCCCAAATGGAAAAAGG - Intergenic
1199977922 X:152905240-152905262 CTGCTGCCCCATCTGGCTCAGGG + Intergenic