ID: 999936957

View in Genome Browser
Species Human (GRCh38)
Location 5:156497216-156497238
Sequence CTTCTGTTATTGAGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999936955_999936957 28 Left 999936955 5:156497165-156497187 CCTGCACTCTCTCTCTCTCTCTC 0: 6
1: 128
2: 2445
3: 6520
4: 15631
Right 999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG 0: 1
1: 0
2: 2
3: 33
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999936957 Original CRISPR CTTCTGTTATTGAGGAAAGA TGG Intronic
902915077 1:19633395-19633417 ACACTGTTATTGAGGAGAGAAGG + Intronic
904873859 1:33638453-33638475 GTTCTGTTATTGATGGATGAAGG - Intronic
909233928 1:73128203-73128225 ATTCAGTTATGGAGGAATGAAGG - Intergenic
909584193 1:77270762-77270784 CCTCTTTCATGGAGGAAAGAAGG - Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
913527691 1:119709692-119709714 TTTTTCTTTTTGAGGAAAGAAGG + Intronic
914217436 1:145644948-145644970 CTTCTCTAATTGAGGCAAAAGGG - Intronic
914470005 1:147967633-147967655 CTTCTCTAATTGAGGCAAAAGGG - Intronic
915336481 1:155145757-155145779 CTTGAGTGAGTGAGGAAAGATGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917461348 1:175233158-175233180 GTTCTGTTATCAAGGAAAAAGGG - Intergenic
917652183 1:177088869-177088891 CCTGTTTTATTGAGGAAAGAAGG - Intronic
918106030 1:181415886-181415908 CTAATGTTACTGAGCAAAGAGGG + Intronic
918643636 1:186876049-186876071 CTTATGGCCTTGAGGAAAGAAGG + Intronic
918682521 1:187372882-187372904 CTTATGCTAATGAGGAATGAGGG + Intergenic
919270151 1:195331200-195331222 CTAATGTTATTCAGTAAAGAAGG + Intergenic
920385525 1:205568524-205568546 CTTCTGTTCTGGGGGAAAGGGGG + Intergenic
920687914 1:208123863-208123885 CTTCAGTTATAGAAGAAAGGTGG - Intronic
920778955 1:208969454-208969476 CTTCTACTTTTGAGGACAGAAGG + Intergenic
921358057 1:214305173-214305195 TTTCTGTTTTTAAGGAAAGAAGG + Exonic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923772576 1:236950486-236950508 CTTCTGTTATTCAAGAATGAAGG - Intergenic
1064372565 10:14765601-14765623 CTTCTGTGTTTGTGGAAGGAGGG + Intronic
1064445096 10:15386068-15386090 CTTCTATTACGGAGGAAGGAAGG + Intergenic
1065338155 10:24676238-24676260 CTTGTGTTCTTGAAGAATGATGG - Intronic
1065444065 10:25779623-25779645 TTTCTGTTTTTGAGATAAGACGG + Intergenic
1065941073 10:30564309-30564331 CTGGTGGTATTGTGGAAAGAGGG + Intergenic
1066343998 10:34564348-34564370 GTTCTGTTAGTGAAGAAGGAAGG - Intronic
1068213706 10:53955010-53955032 CCTCAGTTGTTGAGGAAAAAGGG - Intronic
1068706572 10:60083089-60083111 CTTCTGTTCTTGGAGAGAGAAGG + Intronic
1069350112 10:67515357-67515379 TTTCTGATATAGAGAAAAGAAGG - Intronic
1069792541 10:71032175-71032197 CATCTATTATTTAGGAAAGGAGG + Intergenic
1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG + Intronic
1070011615 10:72480715-72480737 CCTCTGTAATTGTGGAGAGAGGG - Intronic
1070112327 10:73497661-73497683 GCTGTGTTATTGAGGACAGAAGG + Exonic
1071178469 10:82955208-82955230 ATTCTGTGTCTGAGGAAAGATGG + Intronic
1071736916 10:88311115-88311137 TTTCTGGAATTGAAGAAAGAGGG + Intronic
1072256339 10:93624873-93624895 CTCCTCTTATGGTGGAAAGATGG + Intronic
1072522817 10:96243712-96243734 CTTCTTTTATTGAATGAAGAAGG - Intronic
1073415638 10:103379439-103379461 GTTCTGTTAGTAAGGAAAAAGGG + Intronic
1076002978 10:126927090-126927112 CTCCAGTCATTGAGGAAATAAGG + Intronic
1078276417 11:9852101-9852123 GTTCTGTTATATAGGCAAGAGGG + Intronic
1078409828 11:11105281-11105303 CCTCTTTCATTGAGGAGAGAAGG + Intergenic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1079170251 11:18086948-18086970 TTTCTGTTCTTGAAGAATGATGG + Exonic
1079975309 11:27083740-27083762 CTTCTCTTGTTGGGGAAAAAGGG - Intronic
1080096101 11:28408897-28408919 TTTGTGTTATTGTTGAAAGAGGG - Intergenic
1080260771 11:30347683-30347705 CTTCTTTTATTGTGGCAAGAAGG - Intergenic
1080853423 11:36091059-36091081 CTTCTCTTCTAGAGGATAGAGGG - Intronic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1082167497 11:48965410-48965432 CTCCTGTTGTTCAGGAAGGAGGG - Intergenic
1084001616 11:66298285-66298307 GTTCTGTTATTGGGGAAGGGAGG - Intergenic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1086947794 11:92860452-92860474 CTTCTAGTATGGAGGAGAGAAGG + Intronic
1087166817 11:95012927-95012949 CTTCTGTAGTTGAGGTCAGAGGG - Intergenic
1088396092 11:109371372-109371394 CTTATATTAGTGAGGAAGGAGGG - Intergenic
1088785225 11:113175497-113175519 CACCTCTTATTGAGGAATGAGGG - Intronic
1088850211 11:113698058-113698080 CCTCTGCTCTTGAGGAGAGAGGG - Intronic
1091249402 11:134129625-134129647 CTTCAGTTATTGGTGAAAGAAGG + Intronic
1092698212 12:11198055-11198077 CTTCTCTTATTGAGAGAAGACGG - Intergenic
1095122009 12:38430649-38430671 CTTCAGTTATTGAAGATACAGGG + Intergenic
1096099173 12:48958503-48958525 CTGCTGTAAATGAGGAGAGAGGG - Intergenic
1096752479 12:53770167-53770189 CTTCTGTCATGGAGTAAATAGGG + Intergenic
1097571803 12:61342580-61342602 CTTTTGTTATAAAGAAAAGAGGG + Intergenic
1097801997 12:63924677-63924699 CTTTTTTTATTGAGGATTGAAGG + Intronic
1098157439 12:67614265-67614287 CTTCTTTTAGTGAGGAATCAAGG - Intergenic
1098244162 12:68499174-68499196 CTTCAGTTATTGATGAAAATAGG + Intergenic
1099593750 12:84629861-84629883 TTTTTGTTATTCGGGAAAGAGGG - Intergenic
1100931319 12:99613142-99613164 TTTCTATTGTTGAGTAAAGAAGG + Intronic
1101475819 12:105047245-105047267 ATTCTGTTACTAAGGACAGAGGG - Intronic
1101523353 12:105505184-105505206 GTTCTATTATGGAGGAATGAAGG + Intergenic
1101530476 12:105568878-105568900 CTTATGTTAATGAGCAATGAGGG + Intergenic
1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG + Intronic
1102037379 12:109779708-109779730 CTTGTGTCCTTGAGGAAAGCTGG + Intergenic
1102892493 12:116571210-116571232 CTTCTGTGGTTGAGGAAAGGTGG + Intergenic
1103383053 12:120509935-120509957 CTACAGTGAGTGAGGAAAGAAGG - Intronic
1104592230 12:130093785-130093807 GGTCTGTCATTGAGGGAAGAAGG - Intergenic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1107174691 13:37386539-37386561 TTTCTGGTATTTAGAAAAGAAGG - Intergenic
1108165363 13:47687520-47687542 CTTTTGATATTAAGGAAAGATGG + Intergenic
1110167231 13:72457943-72457965 CTTCTGTCATTGTGAAGAGAAGG + Intergenic
1111179614 13:84645896-84645918 CTTCTGCTAATGAGCAATGAGGG + Intergenic
1111436099 13:88210239-88210261 CATCTGTTATTGAGGAGAGAAGG + Intergenic
1112063357 13:95765005-95765027 CTTTTCTAATTGAGGAAAGCAGG - Intronic
1112854616 13:103751939-103751961 TTTCTTTTATTGAAGAAAGTTGG - Intergenic
1112921381 13:104616804-104616826 CTCCTGCAATTTAGGAAAGAAGG + Intergenic
1113535125 13:111060151-111060173 ATTCTTTTATTGAGGAAATTCGG - Intergenic
1114257233 14:21013509-21013531 CTGATGTTAGTGAGGAGAGAGGG + Intergenic
1114327790 14:21606780-21606802 CTTCTTATATTGAGGAGTGAAGG + Intergenic
1115758526 14:36554350-36554372 CTTCTCTTATTGAGAAAATCAGG + Intergenic
1119644476 14:76338440-76338462 CATCTGTTATTCATCAAAGATGG + Intronic
1119816019 14:77568499-77568521 CTTCTGTTAATTAAGAGAGAGGG + Intronic
1120716350 14:87845112-87845134 TTTCTGTTATTAATGAATGATGG - Intronic
1120853617 14:89193541-89193563 CTTCTGTTATTCATCAAAGATGG + Intronic
1121968665 14:98335876-98335898 TTCCTGATATTGAGAAAAGATGG + Intergenic
1125028583 15:35054455-35054477 ATTCTGGTATAGGGGAAAGAGGG + Intergenic
1125431505 15:39599361-39599383 TTTCTGTTATTTAGGTAAGGGGG - Exonic
1127075632 15:55322682-55322704 CTTCCGTTATTGAGAAATTAGGG + Intronic
1128147942 15:65343189-65343211 TATCTGTTCTTGAGGGAAGATGG + Intronic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1128704518 15:69828835-69828857 CTTCTTTTAGGGTGGAAAGATGG + Intergenic
1128789395 15:70422126-70422148 GCTCTGTTATTAAGGAAGGAGGG + Intergenic
1128890546 15:71328021-71328043 CTATTGTAATGGAGGAAAGAAGG - Intronic
1129739553 15:77983668-77983690 AATCTGTTGGTGAGGAAAGAGGG + Intergenic
1129846354 15:78769379-78769401 AATCTGTTGGTGAGGAAAGAGGG - Intronic
1130255565 15:82324547-82324569 ACTCTGTTGGTGAGGAAAGAGGG + Intergenic
1130509851 15:84580567-84580589 CTTCTCTTAGCAAGGAAAGAGGG + Intergenic
1130599402 15:85265439-85265461 ACTCTGTTGGTGAGGAAAGAGGG - Intergenic
1134686002 16:16159248-16159270 CTTCTGAGCTTGAGGAAAGCAGG - Intronic
1134887486 16:17806570-17806592 CTTCTGGTTATGAGGAAGGAGGG - Intergenic
1136599007 16:31271662-31271684 GTTCTAGTATTGAGGAGAGATGG + Intronic
1137832278 16:51555157-51555179 TTTCTGGTTTTGAGGAATGAAGG + Intergenic
1137844050 16:51669501-51669523 TTTCTCTTATTGGGGAAGGAGGG + Intergenic
1138716322 16:59027321-59027343 CTTGTGTTATTGCTGAAACATGG - Intergenic
1139166578 16:64573092-64573114 CCTCTGGTTTTGAGGAGAGAAGG - Intergenic
1141318883 16:82988084-82988106 CTTCAATGATTGAGGAAGGAGGG - Intronic
1142045870 16:87924937-87924959 CCTCTGTGATTGGGGAGAGAAGG - Intronic
1142063779 16:88048369-88048391 TTTCAGTAATGGAGGAAAGAAGG + Intronic
1142842306 17:2643045-2643067 CTACTTTTATTTAAGAAAGAGGG - Intronic
1148730263 17:49830495-49830517 CTTCTGTTATGCAGATAAGAGGG - Exonic
1149038710 17:52160867-52160889 TTTCTTTTTTTGAGGAGAGAGGG + Intergenic
1149084588 17:52699913-52699935 CTCCTGTTGGTGAGGAATGAGGG - Intergenic
1153197581 18:2617609-2617631 CTTCTGTTTCGGAGTAAAGATGG - Intergenic
1153349116 18:4059141-4059163 CCTCTGTAATTGTGGCAAGATGG + Intronic
1153435807 18:5066832-5066854 CCTCTGATAGTGAGGAAAGGTGG - Intergenic
1153632274 18:7082967-7082989 CTTGTGTTATTGAGGAGGGGAGG + Intronic
1153682989 18:7518035-7518057 CTTCAGTTGCTGAGGACAGATGG - Intergenic
1156616552 18:38792617-38792639 TTTTTGTTATTAAGAAAAGAGGG - Intergenic
1157154118 18:45248331-45248353 CTTCTGTTCTTGAGACATGAGGG + Intronic
1157659987 18:49432782-49432804 ATTCTGTTATTTGGTAAAGATGG + Intronic
1158067604 18:53431377-53431399 TTTGTGTTATTGAGAAAATATGG + Intronic
1158207947 18:55014547-55014569 TTTCTGATATTGAGGAAAATAGG - Intergenic
1159255608 18:65941336-65941358 TTTTTTTTAGTGAGGAAAGAGGG - Intergenic
1159279181 18:66262469-66262491 CTTCTCCAATTGAGGAATGATGG + Intergenic
1159752536 18:72320276-72320298 CTTCTGTGATTCTGGAAATACGG - Intergenic
1160040097 18:75337420-75337442 CTTCTGTTAGGAAGGAAAAAGGG + Intergenic
1161729736 19:5952003-5952025 TTTCTGTGCTTTAGGAAAGAGGG + Intronic
1163302284 19:16455578-16455600 CTTCTCTTAGTGAAGCAAGATGG - Intronic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1165346800 19:35253714-35253736 CTACTGTTATTGAGGTCACAGGG + Intronic
1165462848 19:35954222-35954244 CTTCTGTGCCTGAGGAAGGAGGG - Intergenic
1166268973 19:41701890-41701912 CTCCTGTTAATGAGCAAAAAGGG + Intronic
1167960375 19:53100199-53100221 TTTCTGTAAATGTGGAAAGATGG - Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
926064957 2:9831238-9831260 CTTATGTCAGTGAGGAAATAGGG + Intergenic
926741803 2:16117490-16117512 CATCTGTCATGGAGGAGAGAAGG - Intergenic
927234383 2:20856905-20856927 CTTTACTTAATGAGGAAAGAGGG - Intergenic
927757013 2:25716844-25716866 CTCCTGACATGGAGGAAAGAAGG - Intergenic
928601153 2:32904752-32904774 TTTCTGTTATAGAGGATAAAGGG + Intergenic
928724737 2:34159221-34159243 TGTCTGTTATTGTGTAAAGATGG - Intergenic
929085203 2:38161161-38161183 CTTCAGTTCTGGAGGAAAGCTGG + Intergenic
929827627 2:45321691-45321713 CTGCAGTTATTCAGGAGAGAAGG + Intergenic
930423812 2:51187950-51187972 ATTCTTTTAATGAGGAAAAAAGG + Intergenic
931962419 2:67496665-67496687 TTTATGTTATTCAGGAAAGTTGG - Intergenic
933113463 2:78434681-78434703 CTGTTTTTATTGAAGAAAGAAGG - Intergenic
933372801 2:81438603-81438625 CTTATGTAAGTGAGGAAAAAAGG + Intergenic
935384883 2:102489490-102489512 CTTCTGAACTTGAAGAAAGATGG - Intronic
937764288 2:125641468-125641490 GGACTATTATTGAGGAAAGAGGG - Intergenic
938052182 2:128184514-128184536 CTTTTGTTAGGGAGGAAGGATGG - Intronic
940835789 2:158520034-158520056 CTTCTTATATAGAGGAAAGAAGG - Intronic
940859303 2:158755737-158755759 TTTCTTTTATTGAAGAAACAAGG - Intergenic
941360732 2:164548260-164548282 CTTCTGTTAGAAAAGAAAGAAGG + Intronic
941629758 2:167871115-167871137 GCTCTGTGATTGAGGAAGGATGG + Exonic
943620403 2:190141743-190141765 TTACTGTTATTGAGCAAAGGGGG + Intronic
944271848 2:197793031-197793053 CTTCTGTTGTTTATGGAAGAGGG - Intergenic
945846063 2:214946543-214946565 CTTCTGGTATTATAGAAAGATGG + Intronic
945951273 2:216041142-216041164 TTTCAGTTTTTGAGGAAAGCGGG - Intronic
946217245 2:218194012-218194034 GTTCTGTTAGTGAGGGAGGAAGG - Intergenic
946344747 2:219100057-219100079 CTTCGGTTATTATGGCAAGAAGG + Intronic
946358385 2:219203779-219203801 CTTCTTTTATTCAGGAAGCAAGG + Intronic
947562997 2:231174369-231174391 CATCTGATATTGAGGAAACAAGG - Intergenic
1168796834 20:615962-615984 TTTCTGTTAGTGAGGAAGAAGGG + Intergenic
1168888919 20:1281057-1281079 GTTCTATTATTGAGGGAGGAGGG + Intronic
1168890948 20:1295111-1295133 CTGCTGTTAATGTGGAAGGAGGG + Intronic
1169646449 20:7815355-7815377 TTTTTGTTTTTGAGTAAAGACGG + Intergenic
1170307319 20:14952974-14952996 CTTCTATTTTTAAGAAAAGAGGG + Intronic
1172452924 20:35040989-35041011 TCTCTGTCATTGAGGAGAGACGG - Intronic
1173308084 20:41871055-41871077 CTTATGTTAATGAGCAATGAGGG - Intergenic
1174004908 20:47402866-47402888 CTTCTGTTATTAAAGAAAGAAGG - Intergenic
1178094227 21:29197113-29197135 TTTCTGTTGTGGAGGAGAGAAGG + Intronic
1181471100 22:23140417-23140439 CCTCTGTAGTTGGGGAAAGATGG - Exonic
1184177205 22:42795114-42795136 AATCTGTTGGTGAGGAAAGAGGG - Intergenic
949781697 3:7696510-7696532 TTTCTGTTACTAAGGAAACATGG - Intronic
949783172 3:7712513-7712535 CTACTGTAATTCAGGAAAGAGGG - Intronic
949793175 3:7816021-7816043 CATCTGTTAATGAGGACAAAAGG - Intergenic
951124384 3:18966708-18966730 CATTTGATATTGTGGAAAGAGGG + Intergenic
951417652 3:22444890-22444912 CTTCTTCTAATGAGGAAGGAAGG + Intergenic
951545668 3:23822481-23822503 CTTTTTTTGGTGAGGAAAGAGGG - Intronic
952000767 3:28783291-28783313 CTTTTGTCATGGAGAAAAGAAGG + Intergenic
952277355 3:31890320-31890342 CTGCTGTGATTTAGGAAAGCTGG - Intronic
953559537 3:43975900-43975922 CTTCTGTCTTTGAGGTCAGAAGG + Intergenic
955028796 3:55196582-55196604 GTTCTCTTATTGAGAAAAAAAGG - Intergenic
956516699 3:70057207-70057229 ATTTTGTTATTGGGGAAAGGGGG + Intergenic
958833567 3:99117837-99117859 CTTCTGTTTGTGAGGAAGGTGGG + Intergenic
959412776 3:106046159-106046181 CTTCTTACATTCAGGAAAGAAGG - Intergenic
960465310 3:117990432-117990454 CTTCTGAAATAGAGAAAAGAGGG + Intergenic
960839415 3:121941118-121941140 CTTCTGTCATTGGAGAAAGGTGG - Exonic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962453830 3:135547050-135547072 CTTGTGTGATTTAGGAAAGATGG + Intergenic
962681590 3:137806237-137806259 CATCTTGTATTTAGGAAAGAAGG + Intergenic
963134288 3:141886686-141886708 TTTCTTTTATAGAGGAAACAAGG - Intronic
963337190 3:143988638-143988660 CTTATGATTTTGAGGTAAGAGGG - Intronic
963626200 3:147677082-147677104 CTACTGTGATTTAGCAAAGAAGG - Intergenic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
966053223 3:175648203-175648225 CTTGTGTTATTGAGAACACATGG + Intronic
967450595 3:189618559-189618581 CCTCTGTTCTTGAGGGTAGAGGG + Intergenic
967845805 3:194041765-194041787 TTTCTGACATTCAGGAAAGAGGG - Intergenic
967874699 3:194259912-194259934 AATCTGTTATTAAGGAAAAAGGG - Intergenic
968015592 3:195329556-195329578 GTTGTGTTATGAAGGAAAGAGGG - Intronic
971881103 4:32373959-32373981 ATTTTTTTTTTGAGGAAAGAAGG + Intergenic
972155914 4:36161679-36161701 ATCTTGTTATTGAGGAAAGCAGG - Intronic
974930273 4:68353187-68353209 TTTCTGTAGTTCAGGAAAGATGG + Intergenic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
978732114 4:112039823-112039845 ATTCTATTATTAAGGAAGGAGGG + Intergenic
980961616 4:139481469-139481491 GTTCTGTTAGTAAGAAAAGAGGG - Intergenic
981640565 4:146939107-146939129 CTTCTGTTTTGGAAGAAGGAGGG - Intronic
982168854 4:152641803-152641825 TTTTTCATATTGAGGAAAGAAGG - Intronic
982341489 4:154303693-154303715 GTCCTGGTATTGAAGAAAGAAGG + Intronic
982371395 4:154637362-154637384 CTTGTGGTTCTGAGGAAAGAAGG + Intronic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
984248648 4:177306069-177306091 CTTCTGTCTTTAAGGAATGAGGG + Intergenic
984769728 4:183426955-183426977 CCTCTGTTACTGAGGAAGGCAGG + Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
987089811 5:14500589-14500611 CTTCTGTTGATGAGAAAAGGGGG + Intronic
988385092 5:30552683-30552705 GTTATGATATTGGGGAAAGAAGG + Intergenic
988795947 5:34653961-34653983 CTTCTACTAATGAGGAAAGGGGG + Intergenic
988815484 5:34830288-34830310 CATCATTTATTGAGGAATGAGGG + Intronic
988918725 5:35921387-35921409 CTTCTTTTATGGATGGAAGAGGG - Intronic
990041857 5:51386551-51386573 CTTCTGTTATTCCTGAAAGATGG + Intronic
991093836 5:62718891-62718913 TTTCTGTTATTAAGTAATGATGG + Intergenic
991289782 5:65022443-65022465 TTTCTTTTATTAAGGAAAGCTGG - Intergenic
991376057 5:65968491-65968513 CTACATTTATTGAGTAAAGAAGG + Intronic
995201668 5:109431851-109431873 TTTCTGTTATTAAAGAAAGCAGG + Intergenic
995426893 5:112034595-112034617 TTTCAGTCATTGAGCAAAGAGGG - Intergenic
996597309 5:125220184-125220206 CTTTTGTGCTTGATGAAAGAAGG - Intergenic
996892988 5:128444666-128444688 CCTATGTTCTTTAGGAAAGAGGG - Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1001459349 5:171896028-171896050 CTCCTGTTATTCAGGAAATGAGG - Intronic
1001868962 5:175133649-175133671 CTTCTGTCATTTATGTAAGATGG - Intergenic
1002377762 5:178800410-178800432 ATTCTATTATTGAGGAAGGAAGG - Intergenic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1003884741 6:10511508-10511530 TCTCTGGTATAGAGGAAAGAAGG + Intronic
1003935687 6:10973000-10973022 CTTCTGTTAATAAGGAAACAGGG + Intronic
1005532709 6:26723419-26723441 GTTCTGTTGGTGAGGAAAGAGGG + Intergenic
1005538086 6:26778245-26778267 GTTCTGTTGGTGAGGAAAGAGGG - Intergenic
1006783039 6:36645091-36645113 CGTCTGGTGTGGAGGAAAGAGGG - Intergenic
1008261943 6:49377458-49377480 CTTCTTTCATTGAGGAGAGAAGG + Intergenic
1008308162 6:49931424-49931446 CTACTTTTATTGAGAAAAGATGG + Intergenic
1008320994 6:50113540-50113562 CTTCTGTTGTTGTGGAGGGAGGG - Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1008687695 6:53943509-53943531 CCTCTGTTGTTGAAGAGAGAGGG - Intronic
1009006728 6:57797852-57797874 GTTCTGTTGGTGAGGAAAGAGGG - Intergenic
1009008940 6:57820615-57820637 GTTCTGTTGGTGAGGAAAGAGGG - Intergenic
1009642924 6:66361621-66361643 CCTCTGCTCTTGAGGAGAGAGGG + Intergenic
1010211545 6:73366329-73366351 ATTTTGTTATTGGGGAAAAAGGG - Intergenic
1010255093 6:73748518-73748540 CTTCTGATCTAGTGGAAAGAAGG - Intronic
1010700198 6:79035355-79035377 CTTGTGTTATTGAGCAGAGGGGG - Intronic
1012140544 6:95621523-95621545 CATATGTTATTAAGGAAAAATGG + Intergenic
1014002306 6:116378130-116378152 CTTCTTTTCTTCAGGGAAGATGG - Intronic
1015439479 6:133231819-133231841 CTTCTGTTCTTGTAGACAGAGGG + Intergenic
1016070898 6:139737761-139737783 GTTCTGTTAGTGAAGAAACATGG + Intergenic
1016832368 6:148446411-148446433 GTTCTTTTCTTAAGGAAAGAGGG + Intronic
1017547850 6:155470568-155470590 CCTCTGTTAATGAGTCAAGAGGG + Intergenic
1018428420 6:163703886-163703908 CATCTGTTAATGGGGAAGGAGGG - Intergenic
1018524337 6:164690947-164690969 CTTCTGTTGTTGAGAAACGATGG + Intergenic
1020032991 7:4945880-4945902 CCTCTGTCCTGGAGGAAAGAAGG - Intronic
1020908964 7:14104393-14104415 CTTCTGTTACTGGTGAAGGAGGG + Intergenic
1021103244 7:16607820-16607842 CTTCTGTTACTGAGGAAGCTGGG - Intronic
1022127566 7:27372954-27372976 CCTTTGTTCATGAGGAAAGATGG + Intergenic
1022802437 7:33789031-33789053 CATCTGTCATTAATGAAAGACGG + Intergenic
1023652912 7:42389747-42389769 CTACTGTACTAGAGGAAAGATGG - Intergenic
1024567490 7:50693998-50694020 CTTCTGTTATGGAGAATAGAGGG + Intronic
1027998417 7:85457930-85457952 GGTCTGTTTCTGAGGAAAGACGG + Intergenic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1029798660 7:102923129-102923151 ATTCTTTGATTTAGGAAAGAAGG - Intronic
1030776743 7:113543160-113543182 CTTATGCTAATGAGGAATGAAGG - Intergenic
1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG + Intergenic
1032691468 7:134291553-134291575 CTTCTCTTCTTCTGGAAAGATGG - Exonic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1032891692 7:136201454-136201476 CTTTTGTTACTGATAAAAGATGG - Intergenic
1034535327 7:151722525-151722547 CATCTCTCACTGAGGAAAGAAGG + Intronic
1035400351 7:158561020-158561042 ATTCTGTTAGTGTGGCAAGAAGG + Intronic
1035915420 8:3615677-3615699 CTACTATTAGAGAGGAAAGAAGG - Intronic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1036703527 8:11029891-11029913 CTTCTGTTATGGATGGAAAATGG - Intronic
1038173905 8:25163697-25163719 TTTCTGTTACTAAGGAAGGAGGG + Intergenic
1038998888 8:32957526-32957548 GTTCTGTTATTAAGGAAAAGGGG - Intergenic
1040028303 8:42801865-42801887 CTCGTGTTATTGAGAACAGAAGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041382678 8:57267481-57267503 CTTCTGTGAATGAGGAATGTGGG + Intergenic
1044420790 8:91993636-91993658 CTTCTGTTATTGAGGAGCTGGGG - Intronic
1047645459 8:126865415-126865437 CTTTTGGTATCTAGGAAAGAAGG - Intergenic
1048356563 8:133658511-133658533 TTTCTGTTTTTGAGGAAATGAGG + Intergenic
1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG + Intergenic
1050479104 9:6071718-6071740 CTTATGTTATTGAAAAAAGCAGG + Intergenic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1052399691 9:27985126-27985148 CTTTTCTGAATGAGGAAAGAAGG + Intronic
1052984764 9:34478780-34478802 CTTATGCTATTGACCAAAGAAGG - Intronic
1053348069 9:37392684-37392706 CTTCTATGAGTTAGGAAAGATGG - Intergenic
1055369628 9:75583365-75583387 ATTCTGTTAGCAAGGAAAGAGGG + Intergenic
1056404955 9:86264519-86264541 CTTTTATTATTGAGGGGAGAGGG - Intergenic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1059288348 9:113197773-113197795 CTTCAGTTATTGAAGTAAAATGG - Intronic
1060002342 9:119969837-119969859 CTTCTGCTGTTGAGGACAGTGGG - Intergenic
1186079760 X:5917686-5917708 CTTCTGATATTCATGAAAGCAGG - Intronic
1186511010 X:10129784-10129806 CTTCTGTTTTCCAGGGAAGATGG - Intronic
1186662644 X:11684651-11684673 CTTCAGTTATTGAGGAAACTGGG + Intergenic
1187368394 X:18683388-18683410 CTTGTCTTATTGAGGAAAAGAGG - Intronic
1187630639 X:21166619-21166641 TTTGTCCTATTGAGGAAAGATGG + Intergenic
1189420572 X:40853946-40853968 CTTCTGAGATTGTGAAAAGAGGG + Intergenic
1193343855 X:80383406-80383428 CTTCTTTTCTAGAAGAAAGAAGG - Intronic
1194364238 X:92994856-92994878 TTTGTGTTATTTAGTAAAGATGG - Intergenic
1194422711 X:93696303-93696325 CTTCTGCTATTGAACAGAGAGGG - Intronic
1194786443 X:98090130-98090152 CTCCAATTATTGAGGAAACAAGG + Intergenic
1195217831 X:102717834-102717856 ATTCTGTTCTTGAGTTAAGAAGG + Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1196910251 X:120477591-120477613 GTTCTGTTACTAAGGAAGGAGGG - Intergenic
1198482243 X:137051979-137052001 CTTCTGTAAGTGGGGAAAGTGGG + Intergenic
1198653488 X:138889189-138889211 CTTCTGTAGTTCAGCAAAGAAGG - Intronic
1199686003 X:150266249-150266271 GTTTTGTTAATGAGGAAAAAGGG + Intergenic
1200672471 Y:6111121-6111143 TTTGTGTTATTTAGTAAAGATGG - Intergenic
1200783415 Y:7237344-7237366 CTTCTGTGTGTGAGAAAAGAGGG - Intergenic