ID: 999939837

View in Genome Browser
Species Human (GRCh38)
Location 5:156530419-156530441
Sequence ACTGAAGTCAGCCATAAATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999939837 Original CRISPR ACTGAAGTCAGCCATAAATA CGG (reversed) Intronic
904544533 1:31258467-31258489 GCTGAAGACAGAGATAAATAAGG - Intergenic
906011357 1:42529814-42529836 ACTGTAGTCAGCGATAAGGAAGG - Intronic
908697555 1:66861124-66861146 AATGTAGTCAGTTATAAATAAGG + Intronic
909841571 1:80333961-80333983 CCTGAAGGCAGCAGTAAATATGG + Intergenic
915444003 1:155964478-155964500 ACTGAAGACAGAGATAAAGAAGG + Intronic
915484196 1:156208822-156208844 ACTGAAGACAACCATTACTATGG - Intronic
915751879 1:158219030-158219052 AATGAAGTCAGAAATAAAGATGG - Intergenic
916183940 1:162112979-162113001 ACTGAAGCCAGGCATAATGAAGG - Intronic
916567792 1:165996649-165996671 ATTGAGGTCCTCCATAAATATGG + Intergenic
916666641 1:166973623-166973645 ACTGAAGTCAGCCAGGCATCGGG - Intronic
917416624 1:174817093-174817115 ACTGAAGTCCATCGTAAATATGG - Intronic
918986551 1:191635303-191635325 ACTGCAGTCAGCCAAGAATTTGG + Intergenic
921177213 1:212606066-212606088 ACTGAAGTCAGGGTAAAATAAGG + Intronic
921592107 1:217016037-217016059 CCTGAAATCAGCCATAAGAAGGG - Intronic
921809470 1:219496383-219496405 TCTGAAGTCTGCCATAGAAAAGG - Intergenic
921854403 1:219965791-219965813 ACTAGAGTCAGACGTAAATAGGG + Intergenic
923868675 1:237967332-237967354 GCTGAAGTTAGCCATAAATGGGG - Intergenic
1062827542 10:583819-583841 ACTGATGTGAGCCAAAAACATGG + Intronic
1063873174 10:10442261-10442283 AGTGAAGTAAGCCAGACATAGGG + Intergenic
1064935087 10:20670657-20670679 AATGAAGTCATCCTGAAATAGGG + Intergenic
1068054670 10:51996930-51996952 ACAAAATTCAGCCATAAAAAAGG + Intronic
1068246921 10:54384121-54384143 ACTGCATCCAGCCAAAAATATGG + Intronic
1070713364 10:78699747-78699769 AGTTTCGTCAGCCATAAATATGG + Intergenic
1071881988 10:89909550-89909572 CCTGAAGGAAGCCCTAAATATGG - Intergenic
1072775867 10:98192438-98192460 ACTGAAGTCAGAAATGAAAAAGG + Intronic
1074026832 10:109644729-109644751 ACTGAATTCAGCTATGACTAGGG + Intergenic
1077900401 11:6482745-6482767 ACTGAAGTCAGTCAGACTTAAGG - Exonic
1079573282 11:21971118-21971140 CCTAAAGTCAGCCATAAAAATGG - Intergenic
1079741342 11:24065546-24065568 AATGAAGTAAGCAATGAATAAGG - Intergenic
1080129960 11:28782322-28782344 GCTGCAGTGAGCCATTAATATGG - Intergenic
1080710259 11:34739768-34739790 ACTGAAGGAAGCACTAAATATGG + Intergenic
1081212826 11:40357175-40357197 ACCAAAGTCAGCCAAAGATAGGG + Intronic
1082695810 11:56363150-56363172 AATGTAGTCAGCCATCAGTAAGG - Intergenic
1085680591 11:78571098-78571120 ACTGAAGTGAAGCATAAGTAGGG + Intronic
1086906934 11:92429531-92429553 CCTGAAGGCAGCACTAAATATGG - Intronic
1087309910 11:96529328-96529350 CCTGAAGGAAGCAATAAATATGG + Intergenic
1089828898 11:121307119-121307141 TCTGAAGAAAGCCATCAATAGGG - Exonic
1090906479 11:131079384-131079406 TCTGAAGTCAACCATAAAGGGGG + Intergenic
1093615428 12:21216653-21216675 ACTGGAGTCACCCATGAAAATGG - Intronic
1095541667 12:43316218-43316240 ACAGAATACAGACATAAATAAGG + Intergenic
1097214859 12:57402844-57402866 ACTGCAGCCAGCCAAAAATAAGG + Intronic
1098788417 12:74788588-74788610 CCTGAAGTAAGTCCTAAATATGG + Intergenic
1101025361 12:100598853-100598875 ACTGAAGACAGGTACAAATATGG - Intronic
1101418217 12:104527114-104527136 ACTGTATTCAGAGATAAATAGGG + Intronic
1101472458 12:105011641-105011663 CCTGAAGGCAGCACTAAATATGG - Intronic
1105567783 13:21568233-21568255 ACTGAAATCAGCCAAAAGAAGGG - Intronic
1106986590 13:35359219-35359241 TTTGAACTCAGCTATAAATAAGG - Intronic
1107042293 13:35961877-35961899 AGTGTAATCAGACATAAATAAGG + Intronic
1108194785 13:47982254-47982276 ATAGTACTCAGCCATAAATAAGG + Intronic
1108304815 13:49120330-49120352 CCTGAAGGAAGCCCTAAATATGG + Intronic
1108342792 13:49514438-49514460 CCTGAAGCAAGCCATAAAAATGG + Intronic
1109090335 13:58035475-58035497 ACTTAAGTGATACATAAATATGG - Intergenic
1109759111 13:66803579-66803601 ACTGAAGACAGCCAAAAGAAGGG - Intronic
1111916775 13:94369212-94369234 TCTGAAGTCAGGAACAAATAGGG + Intronic
1112432833 13:99367360-99367382 ACTGAGGGCAGCCAGAAATCTGG - Intronic
1114603370 14:23974164-23974186 ACTGAAGGCAGAAATAAACATGG + Intronic
1115048491 14:29027529-29027551 CCTGAAGGAAGCCCTAAATATGG - Intergenic
1115266220 14:31503336-31503358 TGTGAAGTGAGCCATAAAAAAGG - Intronic
1115825279 14:37264890-37264912 ATTGAAGTCATCCAGAAAAATGG - Intronic
1115908813 14:38232396-38232418 ATTGAAGTCACCAATAAAAATGG + Intergenic
1116237045 14:42292410-42292432 AATGAATGCAGCCATAAAAAAGG + Intergenic
1120449841 14:84653669-84653691 CCTGAAGGAAGCAATAAATATGG - Intergenic
1120622947 14:86788562-86788584 ACTGAGGTCATTCATTAATAAGG - Intergenic
1121707004 14:96003934-96003956 CCTGAAGGAAGCAATAAATATGG + Intergenic
1122112662 14:99513178-99513200 ACTGAAATAAGCAATAAGTACGG - Exonic
1122927553 14:104913302-104913324 CCTGAAAACAGCCATAAGTATGG + Intergenic
1124911544 15:33926240-33926262 AATGAAAGGAGCCATAAATAGGG - Intronic
1126076741 15:44918754-44918776 ATTAAAATCAGCCATAGATAAGG - Intergenic
1126082212 15:44974941-44974963 ATTAAAATCAGCCATACATAAGG + Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1128658509 15:69480437-69480459 AGTGAATTCAGCCATTAAAAAGG + Intergenic
1134290146 16:12898111-12898133 ACTGCAGTCTGACATAATTAAGG + Intergenic
1134365683 16:13576368-13576390 ACTGAAGGCAACCATTAAAAAGG + Intergenic
1139089106 16:63622114-63622136 ACTGAAGACATCCCTACATAGGG + Intergenic
1139267302 16:65652007-65652029 TCTGAACTCAGCCAGAAAAATGG - Intergenic
1140044184 16:71429665-71429687 ACTGAAGTTAGGCACAAAAAGGG + Intergenic
1141257287 16:82414666-82414688 ACTGAATTCTGCCAAGAATAAGG - Intergenic
1142882291 17:2891207-2891229 ACTGTAGTAAGCCATGAATGTGG - Intronic
1145901400 17:28492772-28492794 AGTGATGTCTGCCATGAATACGG + Intronic
1150757464 17:67928171-67928193 ACCGCAGCCAGCCATAAATACGG + Intronic
1153059111 18:977733-977755 ACTGAAGGAAGCACTAAATATGG - Intergenic
1155586210 18:27368830-27368852 ACTGAAATAAGGAATAAATAGGG + Intergenic
1156306066 18:35879172-35879194 AGGGAAGCCATCCATAAATAAGG + Intergenic
1160449419 18:78952071-78952093 ACTGAAACCATCCATAAAAATGG - Intergenic
1161867798 19:6847492-6847514 AATAAAGTCAGCCATCAAAAGGG - Intronic
1166899320 19:46046248-46046270 CCTGAAGGAAGCAATAAATATGG + Intronic
926439115 2:12869386-12869408 CCTGAAGGCAGCCATAGACAAGG - Intergenic
926932523 2:18054687-18054709 AATAAAGTAAGCCATAAATGTGG + Intronic
927975291 2:27333973-27333995 AGTGAAGCCTGCCATATATAAGG - Exonic
928754976 2:34513541-34513563 AATTAAGTCATCTATAAATAGGG - Intergenic
929008961 2:37422442-37422464 ACTGGAGGCAGCCATGAATGTGG - Intergenic
930522959 2:52491255-52491277 ACTGAAGGAAGCACTAAATATGG - Intergenic
934115870 2:88792941-88792963 ACTGAAGTCAGAGATCAAAAGGG - Intergenic
934627722 2:95875970-95875992 ACTGAAGTCAGAGATCAAAAAGG + Intronic
934805844 2:97225326-97225348 ACTGAAGTCAGAGATCAAAAAGG - Intronic
934831676 2:97531846-97531868 ACTGAAGTCAGAGATCAAAAGGG + Intronic
935861389 2:107334205-107334227 ACTGAAGACACCTATGAATAAGG - Intergenic
936482714 2:112900028-112900050 ACTGCAGCCAGCCAAAAACAAGG - Intergenic
939078807 2:137635284-137635306 ACTAAATTCAATCATAAATATGG - Intronic
939942265 2:148364334-148364356 CCTGAAGGAAGCCCTAAATATGG + Intronic
939951133 2:148474782-148474804 ACTCAGGACAGCCATTAATATGG + Intronic
940824698 2:158397619-158397641 CCTGAAGGAAGCCATAAACATGG + Intronic
940881305 2:158949536-158949558 ACTTAAGTCACCCATAGAAAAGG + Intergenic
943196929 2:184765197-184765219 ACTGAAGTCAGAGATAAAATTGG - Intronic
943418112 2:187634576-187634598 ACTGAATTCAGAAATAAACAAGG - Intergenic
944456311 2:199898408-199898430 GCTGAATTCATTCATAAATAGGG + Intergenic
945871541 2:215231968-215231990 ACTGAAGTGGCCCATAAATGTGG + Intergenic
1169582684 20:7042104-7042126 AATGAAATCAGCAATAAACAAGG - Intergenic
1175676343 20:60949613-60949635 ACACAAGTCAACCATAAACAAGG - Intergenic
1177300005 21:19231511-19231533 AGAAAAGTCAGCCATAATTAAGG - Intergenic
1177753339 21:25314459-25314481 ACTGAAGCAAGTCATAAACAAGG - Intergenic
1178068764 21:28937017-28937039 GGTGAGGTCAGCCATAAAAATGG - Intronic
1179342479 21:40525887-40525909 ACAGACCTCAGCCATAGATAAGG + Intronic
951931332 3:27970453-27970475 ACTGGAGACAGTCATAAAAATGG + Intergenic
952036445 3:29207624-29207646 ACTGAAGTCAACAATGCATAAGG + Intergenic
952267504 3:31800882-31800904 TCTGAAGTAAGCCTAAAATAGGG + Intronic
952467398 3:33604377-33604399 ACTGCAGTGAGCCATGATTATGG - Intronic
954015227 3:47683398-47683420 AATGATGTCAGACAAAAATAAGG + Intronic
955958152 3:64311611-64311633 GCTAAAGCCAGCCAAAAATATGG + Intronic
959381374 3:105645102-105645124 ACAGAAAGCAGCCATAAAGAAGG + Intergenic
959694700 3:109236324-109236346 CCTGAAGGAAGCAATAAATATGG + Intergenic
960128688 3:114028807-114028829 ACAGAAGTCAGTTACAAATAAGG + Intronic
960558488 3:119055887-119055909 AATGAAGTCAGAAATAAAGATGG + Intronic
963427121 3:145144642-145144664 ATTAAAGTCAGCCACAAAAAAGG + Intergenic
965823581 3:172709060-172709082 CCTGAAGTCAGCAATAGATGAGG - Intronic
970585371 4:17509987-17510009 ACAGAACACAGCAATAAATAGGG + Intronic
971668104 4:29519243-29519265 ACTGTAATCAGCCATAAAGTTGG - Intergenic
971679237 4:29675140-29675162 CCTGAAGGAAGCCCTAAATACGG + Intergenic
971808995 4:31399017-31399039 ACTGAAGACATCCATATTTAAGG + Intergenic
975288897 4:72653038-72653060 ACTGAAGTCAACCATGGGTATGG - Intergenic
975825546 4:78316269-78316291 ACACAAGTCAGGCATACATAAGG - Intronic
976482432 4:85560388-85560410 ACTGAAATGAACCATAAAAAAGG - Intronic
977048935 4:92102564-92102586 TGGGAAGACAGCCATAAATATGG - Intergenic
977150101 4:93500672-93500694 TCTGAATTTAGGCATAAATAAGG + Intronic
978076978 4:104542948-104542970 CCTGAAGTAAGCACTAAATATGG + Intergenic
979342896 4:119548660-119548682 ACTGAAGAAAGACAAAAATAAGG - Intronic
980282432 4:130738105-130738127 TCTAAACTCAGCCATAAAGATGG - Intergenic
981274604 4:142883959-142883981 AGAGGAGTCAGCCACAAATAAGG + Intergenic
981789435 4:148520057-148520079 CCTGAAGGAAGCAATAAATATGG - Intergenic
982779967 4:159480452-159480474 ACTGAAGTGAGGCAGAAATCAGG + Intergenic
983159192 4:164389696-164389718 TCTGAAGTGAGCGATATATAAGG - Intergenic
983424330 4:167563152-167563174 ACTGAAGGAAGCACTAAATATGG - Intergenic
983858391 4:172674115-172674137 ACTGAAGGAAGCACTAAATATGG - Intronic
983949247 4:173620720-173620742 CCTGAAGTAAGCACTAAATATGG - Intergenic
984017931 4:174447795-174447817 ACTGAATTCTGCCAAAAACAAGG - Intergenic
984064775 4:175034496-175034518 GCTGTAATCAGCCATAAAAATGG - Intergenic
984391513 4:179139733-179139755 ACTGAAGTCATCCGGAAATAAGG - Intergenic
988865184 5:35326346-35326368 CCTGAAGGAAGCCATAAATATGG + Intergenic
990659478 5:57996883-57996905 ACTGAAGGAAGCACTAAATATGG + Intergenic
991026454 5:62035808-62035830 CCTGAAGGAAGCCCTAAATATGG - Intergenic
992083602 5:73258445-73258467 ACTGAAATCAGAAATAAAAAAGG - Intergenic
992976671 5:82128439-82128461 CCTGAAGTAAGCACTAAATATGG - Intronic
992977501 5:82136377-82136399 CCTGAAGTAAGCACTAAATACGG - Intronic
993402898 5:87474566-87474588 CCTGAAGGCAGCACTAAATATGG + Intergenic
993890998 5:93473239-93473261 ACTAAAATCTGCCATATATAAGG + Intergenic
994696419 5:103078198-103078220 CCTGAAGGAAGCCCTAAATATGG - Intergenic
995585897 5:113647823-113647845 ACTGAAGGAAGCACTAAATATGG + Intergenic
996036085 5:118760427-118760449 ACTGAAGTCAGCCATGAGTTGGG + Intergenic
996242764 5:121223223-121223245 CCTGAAGGAAGCCCTAAATATGG + Intergenic
998225839 5:140325592-140325614 CCTGAAGACAGGAATAAATAAGG - Intergenic
998660422 5:144230672-144230694 CCTGAAGTCATGTATAAATATGG - Intronic
999939837 5:156530419-156530441 ACTGAAGTCAGCCATAAATACGG - Intronic
1000722585 5:164726906-164726928 AATCAAGTCAGACAAAAATAAGG + Intergenic
1000737750 5:164926999-164927021 ACTGAAGGAAGCATTAAATATGG - Intergenic
1003880181 6:10473448-10473470 GCTGCAGTGAGCCATAATTATGG - Intergenic
1008010692 6:46464788-46464810 CCTGAAGAGAGCCATAAATGAGG - Intronic
1009663539 6:66647036-66647058 ACTGCAGTGAGCCCTAACTATGG + Intergenic
1009945149 6:70334778-70334800 CCTGAAGGAAGCAATAAATATGG - Intergenic
1009953796 6:70427180-70427202 ACTGAAGTCACCCAACAATAGGG + Intronic
1010821133 6:80417489-80417511 CCTGAAGGAAGCAATAAATATGG - Intergenic
1011963727 6:93125346-93125368 AGCCAAGTCAGCCACAAATAGGG + Intergenic
1012262728 6:97106888-97106910 TCTGAAGTAATCCATAAATGAGG + Intronic
1012346733 6:98196548-98196570 ACTTAAGAGAGCCAGAAATATGG - Intergenic
1012596842 6:101051382-101051404 AATGAAGGCAGAAATAAATAAGG - Intergenic
1013666537 6:112355190-112355212 ACTAAAGTTAGCCACAAATTAGG + Intergenic
1014864218 6:126507525-126507547 CCTGAAGGAAGCAATAAATATGG + Intergenic
1016168026 6:140972461-140972483 CCTGAAGGAAGCAATAAATATGG - Intergenic
1022076059 7:26972307-26972329 ACTGAAGGAAGCACTAAATATGG - Intronic
1024717317 7:52094058-52094080 AGAGAAATCAGCCATATATATGG - Intergenic
1026146675 7:67752536-67752558 CCTCAGGTCATCCATAAATACGG + Intergenic
1026251840 7:68678111-68678133 ACAGAATTCATTCATAAATAGGG + Intergenic
1027640815 7:80731539-80731561 ACTTAAGTCAGGCCTAAAAATGG + Intergenic
1027731690 7:81882501-81882523 ACTGAAGACAGCCACAAAGATGG + Intergenic
1028991928 7:97058182-97058204 CCTGAAGTAAGCACTAAATATGG + Intergenic
1029239415 7:99148651-99148673 GCTGAAGTCAGCCATGATGATGG - Intergenic
1030256771 7:107518148-107518170 ACTGAAGGAAGCACTAAATATGG + Intronic
1030544485 7:110874961-110874983 ACTGAAGTCACCCTTTTATAAGG + Intronic
1031247069 7:119327472-119327494 ACTGAAATCAGACATATATTAGG - Intergenic
1032842203 7:135723220-135723242 ACTGAAGACAGCCATCTATCTGG + Intronic
1035133831 7:156680225-156680247 ACTGAAGTCTGCCATCTATTAGG + Exonic
1037249370 8:16875440-16875462 CCTGAAGTAAGCACTAAATATGG - Intergenic
1039159827 8:34604767-34604789 ACTTAAGTCAGCATTAAACATGG - Intergenic
1041567333 8:59293908-59293930 ATGGAAGACAGCCATAAAGATGG - Intergenic
1041795256 8:61740372-61740394 ACTGAAATAATACATAAATATGG + Intergenic
1042341857 8:67687896-67687918 ACTACAGTCAGCCCTAAGTAAGG + Intronic
1043304777 8:78781368-78781390 ACTGAAGGAAGCACTAAATATGG - Intronic
1046592036 8:116218513-116218535 AGTGAAGTCAGCAAAATATAGGG + Intergenic
1047152122 8:122275349-122275371 CCTGAAGGCAGCACTAAATATGG + Intergenic
1048910054 8:139126586-139126608 ACAAATGCCAGCCATAAATATGG - Intergenic
1048914239 8:139166216-139166238 ATTGAACTAAGACATAAATAAGG + Intergenic
1049506820 8:143006747-143006769 CCTGAAGGCAGCACTAAATATGG - Intergenic
1052199963 9:25765875-25765897 ACTGAAGGCAGTACTAAATATGG + Intergenic
1052369453 9:27647176-27647198 CCTGAAGGAAGCCCTAAATATGG + Intergenic
1055408973 9:76007039-76007061 ATTGAAGAAAGGCATAAATATGG - Intronic
1055686439 9:78780036-78780058 AATGAAATAAGCCATAATTAGGG - Intergenic
1056061915 9:82892196-82892218 ACTGAGTTGAGCCATAAATTTGG - Intergenic
1056246743 9:84702992-84703014 ACTGAAGTCAAACGGAAATATGG + Intronic
1059259435 9:112961807-112961829 CCTGAAATCTGCAATAAATAAGG + Intergenic
1059399960 9:114062676-114062698 ACTGAAGTCACCAAGAAAGAAGG - Exonic
1059587670 9:115623237-115623259 ACTTCACTCATCCATAAATATGG - Intergenic
1059714429 9:116900419-116900441 ACTCCAGGCAGCCATAAATGTGG - Intronic
1060333605 9:122699778-122699800 ACTGAAGTCAGAGACAAACATGG - Intergenic
1186166697 X:6834281-6834303 AATAAAGTCAGCACTAAATAAGG - Intergenic
1186755424 X:12665765-12665787 CCTGAAGTAAGCACTAAATATGG + Intronic
1188720832 X:33521212-33521234 ACTGAATACAGGTATAAATAAGG + Intergenic
1189061116 X:37754576-37754598 ACTGAAGTCACCCAGAAAGATGG - Intronic
1191093739 X:56653196-56653218 ACTGAAGGAAGCACTAAATATGG - Intergenic
1191132424 X:57029171-57029193 CCTGAAGGAAGCAATAAATATGG - Intergenic
1191788537 X:64943982-64944004 CCTGAAGGAAGCAATAAATATGG - Intronic
1192598838 X:72440240-72440262 AATGAAGGCAGAAATAAATAAGG + Intronic
1193052202 X:77113355-77113377 CCTGAAGTAAGCACTAAATATGG + Intergenic
1193176918 X:78404593-78404615 ACTGAACTCAGCTCTGAATAGGG + Intergenic
1193657952 X:84221459-84221481 ACTTAAGGCAGTCATAAAAAGGG + Intergenic
1194007917 X:88520152-88520174 CCTGAAGGAAGCAATAAATATGG - Intergenic
1194446972 X:94000548-94000570 TCTGAAGGAAGCAATAAATATGG - Intergenic
1195346602 X:103956135-103956157 CCTGAAGGAAGCCCTAAATATGG + Intronic
1195360840 X:104082706-104082728 CCTGAAGGAAGCCCTAAATATGG - Intergenic
1195844047 X:109207485-109207507 ACTGAAGAAAGCACTAAATATGG - Intergenic
1195985785 X:110628307-110628329 ACTGAAGGAAGCACTAAATATGG + Intergenic
1197049355 X:122040855-122040877 CCTGAAGTAAGCACTAAATATGG - Intergenic
1197619798 X:128734720-128734742 CCTGAAGGAAGCCATAAACATGG + Intergenic
1198436091 X:136618197-136618219 ACTGAAGTGACCCTTAATTAAGG + Intergenic
1198782614 X:140254347-140254369 ACTGAGTTCTGCCATAATTATGG + Intergenic
1198934491 X:141892022-141892044 ACTGAAGACAGCCATCTACAAGG + Intronic
1199011934 X:142768611-142768633 ACTGAAGGAAGCACTAAATATGG - Intergenic
1199559764 X:149150483-149150505 ACAGAATTCAACCACAAATAAGG - Intergenic
1199611119 X:149615091-149615113 ACTGAATTCAGCAATATATAAGG + Intronic
1200834866 Y:7723683-7723705 AGTGAATCCAGCCATAAATTGGG + Intergenic
1200842121 Y:7792972-7792994 ACTGAGGTCAGCTATATGTAAGG + Intergenic
1202342003 Y:23879777-23879799 CCTGAAGTAAGCACTAAATATGG - Intergenic
1202528766 Y:25790308-25790330 CCTGAAGTAAGCACTAAATATGG + Intergenic