ID: 999942156

View in Genome Browser
Species Human (GRCh38)
Location 5:156554664-156554686
Sequence TCTAAATGATTCAGTACTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999942156 Original CRISPR TCTAAATGATTCAGTACTAT GGG Intronic
907374755 1:54027154-54027176 TCTAAATGTCTCATTTCTATTGG - Intergenic
908509024 1:64836389-64836411 TGTAAAGGATACCGTACTATAGG - Intronic
909863587 1:80637821-80637843 GGTAACTGACTCAGTACTATGGG + Intergenic
909906173 1:81198320-81198342 TCTAAGTAATTCAGTGCTTTTGG - Intergenic
911135710 1:94437768-94437790 TGGAAAGGATTCAGTACTCTAGG + Intronic
911710035 1:101061207-101061229 TCTAGATGAGTCAGTACTCAGGG + Intergenic
913115798 1:115695846-115695868 TCTAAATGATTCGGCACTTCTGG + Exonic
916412659 1:164560888-164560910 TTTATATATTTCAGTACTATAGG + Intronic
917755834 1:178096854-178096876 TGTAAATATTTCAGAACTATTGG + Intronic
917824484 1:178803090-178803112 TGTAAATGATTCAGTATTTCAGG + Intronic
918217815 1:182408262-182408284 TCTAAATAATTCTTTAATATAGG - Intergenic
923108800 1:230874906-230874928 TCTAAATGATGCTGGTCTATTGG + Intergenic
1063296400 10:4811130-4811152 TCTAAATGATTCAATCCAATAGG + Intronic
1065365579 10:24933656-24933678 TCAAAATGATTCAATCCTTTGGG + Intronic
1066596787 10:37059693-37059715 TCTAAAGGATTCAGTACTTGTGG + Intergenic
1067961457 10:50856346-50856368 TCAAAATGATTGAGTTATATAGG + Intronic
1075133469 10:119761006-119761028 TCTAAATTATTAAGTACTGTTGG - Intronic
1078168182 11:8909091-8909113 TCTAAAGAAGTTAGTACTATTGG + Intronic
1078998258 11:16726697-16726719 TCTAAATTATTCACAAATATGGG + Intronic
1081148461 11:39596034-39596056 TTAAAATGATTAAGTAATATTGG + Intergenic
1083514941 11:63248167-63248189 TCTAAATCAGTAAGTAATATAGG - Intronic
1084336773 11:68462207-68462229 TTTAAATGTTTAGGTACTATTGG + Intronic
1085009321 11:73126659-73126681 ATTTAATGATTCAGTAATATTGG - Intronic
1085734731 11:79029601-79029623 TCTAAATCACTCAGTTCTCTTGG - Intronic
1085892826 11:80601440-80601462 TCTAAAGGATTCAGTACTTGTGG - Intergenic
1086763032 11:90657757-90657779 TCTAATTGCTTCAGCACTACTGG + Intergenic
1087332856 11:96804444-96804466 TCAAAATAATTCAGTAAGATAGG - Intergenic
1087568934 11:99898869-99898891 TCTAAGTAATTCAGTAGAATAGG - Intronic
1087664258 11:101024935-101024957 TCCAAATGATTCAGTGTTAAAGG + Intergenic
1088173570 11:107024005-107024027 TCTAAAAGTTTCACTACTTTTGG - Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1090442768 11:126737720-126737742 TCTAAATGTTTAATTATTATAGG + Intronic
1093221225 12:16422612-16422634 TCTAAAGGATACAGTACATTGGG - Intronic
1099689095 12:85927614-85927636 TCTAAATTATTCATCACTTTAGG + Intergenic
1100878283 12:98987365-98987387 TCTAAAATATTCAGTATAATGGG - Intronic
1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG + Intronic
1105781709 13:23711193-23711215 TCGAAATGATGCAGTTTTATTGG - Intergenic
1107150896 13:37109809-37109831 TATAAATGATTCATTAATTTAGG + Intergenic
1109707931 13:66123400-66123422 TGTAAATGTTTCACTACTCTGGG + Intergenic
1111144619 13:84164623-84164645 TCTATATGAATCAGGAATATTGG + Intergenic
1113020383 13:105878621-105878643 TCTAAAATATACAATACTATGGG + Intergenic
1113680844 13:112243891-112243913 TCTAAATCATTCATTACTCCTGG + Intergenic
1115523673 14:34258046-34258068 TCTAAATGATTCATTCCTGTGGG + Intronic
1115749983 14:36479640-36479662 TCTAAATGATTAAGTACCCATGG + Intronic
1116619813 14:47186422-47186444 TGAAAATAATTTAGTACTATAGG - Intronic
1117480584 14:56140289-56140311 TTTAAATGAATAAGTACAATGGG - Intronic
1122065266 14:99168763-99168785 TCTAAATGATTCTGTGCCCTTGG - Intergenic
1125183373 15:36902942-36902964 TCCAAATAATTCTGTACTGTTGG + Intronic
1128733588 15:70036909-70036931 GCAAAGTGATTCAGTACTGTGGG + Intergenic
1130744586 15:86637528-86637550 TGTTAATGATTCTGTGCTATGGG + Intronic
1135898774 16:26435367-26435389 TCTAACTGATGCATTACCATAGG + Intergenic
1140181806 16:72727901-72727923 TCTAAATGATAAAGTATCATTGG - Intergenic
1143388680 17:6547396-6547418 TCCAAATAATTCAGAACTGTTGG - Intronic
1145119409 17:20243895-20243917 TTTAAATGACTCAGTACCAAAGG - Intronic
1147491646 17:40873385-40873407 TTTAGATGATTCAGAACTCTGGG + Intergenic
1149733565 17:58971044-58971066 CCTAAATTATTCAGAACTATTGG - Intronic
1158274399 18:55750995-55751017 TCTAAATGATTAAGTAATCATGG + Intergenic
1159283500 18:66317971-66317993 TTTAAATGATTCAGTCTCATAGG + Intergenic
1159604270 18:70458590-70458612 TCTAAATGTTGAAGTACTTTTGG + Intergenic
925964508 2:9051568-9051590 TCTAAAATATTCAGTATTACAGG + Intergenic
930480994 2:51947999-51948021 TCCAAATGCTGCAGTATTATGGG + Intergenic
930509112 2:52322464-52322486 CATAAATGATTCTGTACTATAGG + Intergenic
932162095 2:69469999-69470021 CCTAAATGATTCAGCACTTTGGG - Exonic
932231165 2:70085950-70085972 TCTAAATGCTTTGGTACTGTGGG + Intergenic
936292240 2:111235247-111235269 TCAAAATGATCCAGAACAATAGG + Intergenic
936732351 2:115399002-115399024 TCTACATGATTAAGTGCTAAAGG - Intronic
939525793 2:143292350-143292372 TCAAAATAATTGAGTAATATTGG - Intronic
944183598 2:196924455-196924477 TCAAAATGACTCATTTCTATAGG + Intronic
945228137 2:207554530-207554552 TCTAAAGGATTCAGGAAAATAGG - Intronic
946670511 2:222098882-222098904 TCTAAATGATTCTGTAATTTGGG - Intergenic
948718048 2:239878560-239878582 TCTAGATGGTTCATTACTAGTGG + Intergenic
1169934195 20:10865375-10865397 TAAAAATGATTCATTACTATTGG + Intergenic
1174660112 20:52205104-52205126 TCAAAATAATTCAGTACAATAGG - Intergenic
1177084338 21:16683337-16683359 TCAAAATGATTCAGTATAAAGGG - Intergenic
1177856700 21:26407770-26407792 TGTAAATGATGCAGTACTAGGGG - Intergenic
1178107496 21:29336511-29336533 TCTAAAGGATGCAGGAGTATTGG - Intronic
1182225737 22:28797260-28797282 TCTACCTGATTCAGTATAATTGG + Intronic
1184303019 22:43573956-43573978 TTTAAATAATTCTGTCCTATTGG - Intronic
950250785 3:11463562-11463584 TTTAAATGATTCAGGACTCTTGG + Intronic
952215382 3:31272760-31272782 TGTAAATGATTGAGTACCACTGG + Intergenic
952299468 3:32091738-32091760 CCTAAGTGATCCAGGACTATAGG - Intergenic
953054574 3:39377730-39377752 TCTAAATAATACAGAACTGTTGG + Intergenic
953562724 3:44006162-44006184 TCTAATTGGTACAGAACTATTGG - Intergenic
956532895 3:70240836-70240858 TCTGAAAAATTCAGTAATATAGG + Intergenic
956970806 3:74522953-74522975 TTTAAATTATTCAGTAATTTTGG - Intergenic
958079347 3:88726092-88726114 TCCAAATGATTAAGTAGTGTTGG - Intergenic
961394317 3:126576359-126576381 TCTAATTGTTCCAGTACCATTGG - Intronic
964252258 3:154732142-154732164 TTTAAATTATTCATTTCTATAGG - Intergenic
965237926 3:166151438-166151460 TCTAAATGCTTGAGTAATATAGG + Intergenic
965358535 3:167708714-167708736 TCTAAAAGAATCAGTTCTGTGGG + Intronic
965410431 3:168323391-168323413 TATATAGGGTTCAGTACTATCGG - Intergenic
966113044 3:176426902-176426924 TGTAAGTGATTCAGAACTTTAGG + Intergenic
966296417 3:178428841-178428863 TCAAAAAAATTCAGTAATATCGG - Intronic
971353530 4:25873612-25873634 TCTGAATGGTTCAGCAGTATTGG - Intronic
971870715 4:32234929-32234951 TCTACATGATCCAGTACAAAAGG + Intergenic
972276173 4:37560032-37560054 TCTAGATCATTCAATACCATAGG + Intronic
972697029 4:41457514-41457536 ACTACTTGCTTCAGTACTATTGG - Intronic
974671378 4:65034606-65034628 AGTAAATGATTCAGTCCTCTAGG + Intergenic
974728047 4:65822272-65822294 TCTAAACACTTCAGTAATATTGG + Intergenic
975325401 4:73053431-73053453 TCTGATTGGTTAAGTACTATGGG - Intergenic
977085164 4:92587335-92587357 TCTAGATAATCCAATACTATAGG - Intronic
979149143 4:117286117-117286139 ACTAAATGAGTAACTACTATTGG - Intergenic
979360785 4:119762422-119762444 TCTAAATAATTCAGTCCTTTTGG + Intergenic
979474505 4:121139362-121139384 TCTTGATGATTCAGGCCTATGGG - Intronic
980024379 4:127747953-127747975 TCTACATGATTCACTAGGATGGG - Intronic
981024829 4:140067155-140067177 ACTAAATGATTCAGCCCTAGTGG + Intronic
983756468 4:171343331-171343353 TTTAACTGTTTCAATACTATGGG + Intergenic
984515076 4:180727826-180727848 TCTAAAATATTCACTTCTATGGG + Intergenic
984895145 4:184532703-184532725 TCTAATTGTTTCAGTATCATTGG - Intergenic
991132673 5:63142372-63142394 TATAGAGGGTTCAGTACTATTGG - Intergenic
993131044 5:83898610-83898632 TCAAAATGATTCTATATTATTGG - Intergenic
994057275 5:95432095-95432117 TCTAAAAAATTCAATAATATAGG - Intronic
996251945 5:121346392-121346414 ACTAAGTTATTCAGTACTTTTGG - Intergenic
999942156 5:156554664-156554686 TCTAAATGATTCAGTACTATGGG + Intronic
1004674211 6:17825481-17825503 TCAAAATCATTCAGTACTCTAGG + Intronic
1004982648 6:21043366-21043388 TATAAATGATTCAGTATGAGGGG + Intronic
1006905617 6:37531247-37531269 TGTAAATGATTCAGCACCTTGGG + Intergenic
1008101585 6:47397478-47397500 TCTAATTGATTAATTACTCTAGG - Intergenic
1012528441 6:100205254-100205276 TCAAAATAATTCAGAAGTATGGG - Intergenic
1012954121 6:105550045-105550067 TCTAAATGATTCATGATTACTGG - Intergenic
1013040417 6:106427386-106427408 TCTAAATAATTCAGTATTTCAGG + Intergenic
1015204549 6:130619973-130619995 TCTAAATAATTCAGTTGTTTAGG + Intergenic
1015657355 6:135533824-135533846 TGTAAATAGTACAGTACTATTGG + Intergenic
1019109869 6:169701480-169701502 TTTAAAAGATTCAGTAGTTTAGG - Intronic
1021214325 7:17898300-17898322 TCTAATTGTTTCATTCCTATAGG - Intronic
1023099574 7:36702423-36702445 TTTAACTGATTCAGAACTCTTGG + Intronic
1029991203 7:104964068-104964090 CCTAAATGACTCAGCAGTATTGG - Intergenic
1030158569 7:106483225-106483247 TCGAAATGATTCAGTAAAAGTGG - Intergenic
1031634133 7:124081436-124081458 TCTAAATTCATCAGTACTTTTGG + Intergenic
1032281432 7:130505623-130505645 TTTAAATGATACAGTATTTTAGG + Exonic
1036497422 8:9282095-9282117 TCTAAATCATCCAGTGCTTTAGG - Intergenic
1038038310 8:23704550-23704572 TCTAAATGAGCCAGTGCGATTGG + Intronic
1039801589 8:40961397-40961419 TCTATATGCATCAGTAATATTGG - Intergenic
1041568336 8:59306207-59306229 TCTAATTGTTTCAGCGCTATTGG - Intergenic
1041697539 8:60752097-60752119 TCTAAATCATTCTGTACCATAGG + Intronic
1044237637 8:89849974-89849996 TTTAAATAATTCACTACTGTGGG + Intergenic
1045485886 8:102630834-102630856 TCCAAATGATACTGTACTATGGG - Intergenic
1046313986 8:112476680-112476702 TCTAAATTATTGGGTTCTATAGG - Intronic
1052314485 9:27102363-27102385 TCTGAAAAATTCAGAACTATAGG + Intergenic
1052379147 9:27751292-27751314 TCTAAACCATTAAATACTATAGG + Intergenic
1055365080 9:75535025-75535047 TCTAAAAGCTTCAGTACTGAGGG - Intergenic
1055751296 9:79508519-79508541 GATAAATGAATCAGTACCATAGG + Intergenic
1057736150 9:97663173-97663195 TCTAATTCTTTCAGTGCTATGGG + Intronic
1058044381 9:100340776-100340798 TTAAAATGCTTCAGTAGTATTGG + Intronic
1058500965 9:105615739-105615761 TATATAGGGTTCAGTACTATCGG - Intronic
1062414546 9:136441584-136441606 TCAAAATAATTCATTACGATGGG + Exonic
1186699156 X:12070828-12070850 TTTAAATGATTTAGTTCAATTGG - Intergenic
1187674839 X:21705839-21705861 TCTGAATTATTGAGTACCATGGG - Intergenic
1188948164 X:36334188-36334210 TCTCAATGAATTAGTACTCTAGG - Intronic
1191178922 X:57538635-57538657 TCTAAATCAGTCAGAAGTATGGG - Intergenic
1192306380 X:69964562-69964584 TCTAGATGATTAAATACTAAGGG + Intronic
1193660502 X:84251287-84251309 TCTAACTGATTCAGCACTCTTGG + Intergenic
1194947329 X:100084567-100084589 TCTTTAAGATTCAGTACTCTGGG + Intergenic
1195998066 X:110751122-110751144 CCTAAATGATTCAGGATTTTTGG + Intronic
1196122525 X:112066200-112066222 TGTAGATGATTCTGTGCTATAGG - Intronic
1198889451 X:141376924-141376946 TCTAATTGATTCAGAAATGTTGG + Intergenic
1200971007 Y:9152339-9152361 TTTAAATCATTCAGTTCTCTTGG + Intergenic