ID: 999945574

View in Genome Browser
Species Human (GRCh38)
Location 5:156591670-156591692
Sequence ACACATAGACTACACAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999945564_999945574 21 Left 999945564 5:156591626-156591648 CCAGTTCTCCTCCCTGTTTAGGA 0: 1
1: 0
2: 4
3: 8
4: 230
Right 999945574 5:156591670-156591692 ACACATAGACTACACAGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 169
999945565_999945574 13 Left 999945565 5:156591634-156591656 CCTCCCTGTTTAGGAGATTAATT 0: 1
1: 0
2: 0
3: 13
4: 127
Right 999945574 5:156591670-156591692 ACACATAGACTACACAGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 169
999945567_999945574 9 Left 999945567 5:156591638-156591660 CCTGTTTAGGAGATTAATTAAGG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 999945574 5:156591670-156591692 ACACATAGACTACACAGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 169
999945566_999945574 10 Left 999945566 5:156591637-156591659 CCCTGTTTAGGAGATTAATTAAG 0: 1
1: 0
2: 0
3: 19
4: 153
Right 999945574 5:156591670-156591692 ACACATAGACTACACAGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999945574 Original CRISPR ACACATAGACTACACAGAGG GGG Intronic
900377433 1:2362304-2362326 TCACATTGAATACACTGAGGAGG + Intronic
904627075 1:31812760-31812782 ACACAGAAAATACACAGAGAAGG + Intronic
905179973 1:36159606-36159628 CCACATAGACTACACCGAGCTGG - Intronic
906464383 1:46063154-46063176 TTACAGAGACTTCACAGAGGAGG + Intronic
908393158 1:63701759-63701781 ACAAAAAGAGTACACAGATGAGG + Intergenic
909523079 1:76591756-76591778 CCATGAAGACTACACAGAGGAGG + Intronic
910052941 1:82997524-82997546 AGAGAGAGATTACACAGAGGAGG + Intergenic
911927567 1:103854311-103854333 ACACATAGACTAAAAATAAGTGG + Intergenic
916936458 1:169632990-169633012 ACACATAGACTTGTGAGAGGTGG - Intergenic
918206835 1:182316987-182317009 ACACAGAAACTAGTCAGAGGAGG + Intergenic
919490634 1:198200989-198201011 ACACATAATCTCCACAGAGAGGG - Intronic
920865697 1:209751485-209751507 ACACATACACTAGGGAGAGGAGG + Intergenic
923579154 1:235190955-235190977 ATTCAAAGACTACAGAGAGGCGG - Intronic
924257316 1:242195288-242195310 CCACATAGACTTCTCAGAGGTGG - Intronic
1063205001 10:3822408-3822430 ACACAGAGAGGAGACAGAGGTGG - Intergenic
1065017930 10:21478701-21478723 ACACGTACACTACACCCAGGTGG - Intergenic
1066565398 10:36716851-36716873 CCACAAAGACTAGATAGAGGAGG + Intergenic
1067217466 10:44315165-44315187 ACCCAGAAGCTACACAGAGGAGG + Intergenic
1071234050 10:83623606-83623628 ACACTTAGAGGACACAGAGAAGG - Intergenic
1072566098 10:96617910-96617932 AGACACAGACTGCACAGAGAAGG + Intronic
1073872646 10:107882920-107882942 ACACATAGACTAAACATAAAGGG + Intergenic
1078132342 11:8623208-8623230 ACAAAAAGACTCCTCAGAGGAGG - Intronic
1078488764 11:11749723-11749745 ACAAATATAATACACAAAGGGGG + Intergenic
1082797459 11:57388434-57388456 ACCCACAGACAACACTGAGGGGG - Intronic
1082970356 11:59013698-59013720 ACACAGAGATAACACAGAGAAGG + Intronic
1084939282 11:72603723-72603745 ACACAAAGGCTAGAGAGAGGTGG + Intronic
1086469013 11:87086654-87086676 AAACAAAGACTACTCAAAGGTGG + Intronic
1087527885 11:99340404-99340426 AAACATAGATTACAGAGATGTGG + Intronic
1092886677 12:12930351-12930373 CAAAATAGACTTCACAGAGGAGG - Intergenic
1094457459 12:30653143-30653165 AAACAAAGACCACACAGAGGAGG + Intronic
1095284499 12:40392266-40392288 ACAAATAGACTAAACAGATTTGG + Intergenic
1095329136 12:40936800-40936822 ACACATCAATGACACAGAGGTGG + Exonic
1095574182 12:43715869-43715891 ACCAACAGACTACACACAGGTGG - Intergenic
1099048984 12:77760726-77760748 ACACACAGCATACAAAGAGGGGG + Intergenic
1099050571 12:77777725-77777747 AAACAAATACTACACAGAGAGGG + Intergenic
1099639362 12:85265922-85265944 ACACAGAGACTACACAAAACAGG + Intergenic
1104585289 12:130043836-130043858 ACACATGGACATCACAGGGGAGG + Intergenic
1110160709 13:72374702-72374724 ACATAGAGACTGCACAGAGAGGG - Intergenic
1112725064 13:102293937-102293959 ACAAATTGAGTGCACAGAGGGGG + Intronic
1113557676 13:111251526-111251548 ACACAGAGACTCCAGAAAGGAGG + Intronic
1113707412 13:112443718-112443740 ACACACACATCACACAGAGGGGG + Intergenic
1114229863 14:20771255-20771277 ACACACAGACTCCACAGAAATGG + Intergenic
1114346688 14:21803807-21803829 ATACATACACTGCTCAGAGGTGG + Intergenic
1114755207 14:25252035-25252057 ACAAATATGCTACAAAGAGGAGG - Intergenic
1115464408 14:33699039-33699061 ACACATAGGAAACACAGAGGTGG + Intronic
1115969535 14:38930175-38930197 ACACAAAAACTACACAGACTTGG + Intergenic
1118271526 14:64347278-64347300 ACACTTAGAATACAAGGAGGAGG + Intergenic
1118719654 14:68585147-68585169 AATAATAGAGTACACAGAGGTGG - Intronic
1121814029 14:96915421-96915443 ACACAAAGGCATCACAGAGGAGG - Intronic
1122965398 14:105121797-105121819 AGACACAGTCTACACAGGGGAGG + Intergenic
1123798147 15:23794366-23794388 ACACATAGAGTACAGAGCAGAGG - Intergenic
1124437403 15:29662490-29662512 ACACAAAGACCATACAAAGGAGG - Intergenic
1125952478 15:43764621-43764643 ACACATAAACTACCCAGGTGTGG - Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1128836246 15:70811245-70811267 ACACACAGCCAACACAGAGCGGG + Intergenic
1130459545 15:84150989-84151011 ACACACACAGTACACAGATGAGG - Intergenic
1131543979 15:93300164-93300186 ACACATACACTGCACAGAAAAGG - Intergenic
1133542626 16:6771134-6771156 CCATATAAACAACACAGAGGGGG + Intronic
1137081866 16:36071905-36071927 ACATAAAGACTACACAGAGAGGG + Intergenic
1139463641 16:67142353-67142375 ACCCACAGACTACCCAGAGCTGG + Intronic
1143287429 17:5800714-5800736 AGAGATAGACCACACAGTGGAGG + Intronic
1145126282 17:20302571-20302593 TGACATAGAATACAGAGAGGGGG - Intronic
1146979588 17:37147484-37147506 ACACAAAGACAACACACAGAAGG + Intronic
1149083743 17:52689055-52689077 AGACAAAGACTTCCCAGAGGAGG - Intergenic
1150299976 17:64039798-64039820 ACACACACAGTACACAGGGGAGG + Exonic
1152533185 17:80932673-80932695 GCACAAAGACTACAAAGAGTGGG + Intronic
1157617407 18:48995349-48995371 ACACCTCCAGTACACAGAGGAGG + Intergenic
1158006351 18:52676145-52676167 ACAGGAAGACTCCACAGAGGCGG + Intronic
1159667758 18:71183839-71183861 AGACACAGAACACACAGAGGAGG - Intergenic
1160610319 18:80079201-80079223 ACACATGGACAAAACAGAGTCGG + Intronic
1163205502 19:15799538-15799560 ACACAGAGAAAACACAGATGTGG - Intergenic
1167578095 19:50327371-50327393 ACACAGAGTGAACACAGAGGGGG + Intronic
1168575534 19:57505581-57505603 AAACATGGAGTACAGAGAGGTGG - Intronic
927206394 2:20613779-20613801 ACACACAGAGTACACAGGGATGG + Intronic
929897084 2:45970103-45970125 ACACAGAGACTGCACAGGGAAGG - Intronic
930715109 2:54586668-54586690 ACACAAAGACCAGAAAGAGGGGG - Intronic
931513674 2:63027765-63027787 ACTCATAGAGAACACAGTGGTGG + Intronic
934166747 2:89300897-89300919 GCACATAGACTTCACATAAGGGG - Intergenic
934200534 2:89881560-89881582 GCACATAGACTTCACATAAGGGG + Intergenic
942318489 2:174715316-174715338 ACTCCTAGACTAGACAGAGATGG - Intergenic
942763157 2:179424126-179424148 ATACCTACACTACACAGATGGGG + Intergenic
942905058 2:181170266-181170288 TCCTGTAGACTACACAGAGGTGG - Intergenic
944029874 2:195222562-195222584 ACACATACACAACACAAAGAGGG - Intergenic
945568983 2:211440471-211440493 ATTCAGAGACTACAGAGAGGTGG + Intronic
945729714 2:213518805-213518827 AGACATAGAATAGACATAGGTGG + Intronic
946820409 2:223622897-223622919 ACAAATAGACTAACCAGAAGAGG - Intergenic
947405852 2:229776083-229776105 ACACCTAGAGAACACAGAGTAGG - Intronic
948554944 2:238802663-238802685 ACAGACAGACTTCACAGAGCAGG + Intergenic
1168914865 20:1477305-1477327 ACTCATTGACTCCACTGAGGTGG + Intronic
1171343098 20:24445745-24445767 AAACACAGACTTCACAGAAGTGG - Intergenic
1173342788 20:42168146-42168168 ACACATTGAGTAGACTGAGGAGG + Intronic
1173370586 20:42431052-42431074 ACAAATACTCTAAACAGAGGAGG + Intronic
1173538170 20:43831655-43831677 AAGCACAGACAACACAGAGGCGG + Intergenic
1176003353 20:62844889-62844911 ACAAAAAGACTACACAGACTGGG - Intronic
1176478378 21:7254722-7254744 ACATAAAGACTACACAGAAATGG - Intergenic
1180862786 22:19096125-19096147 AGACCTAGAATACACTGAGGAGG - Intronic
1180922072 22:19526109-19526131 ACCCCTGGAGTACACAGAGGAGG - Intronic
1182349118 22:29688792-29688814 ACACTTATCCTACACAGAGGTGG - Intronic
1184257434 22:43295229-43295251 CCAGAAAGACTACACGGAGGAGG - Intronic
950417830 3:12878434-12878456 GCACATAGACCAGTCAGAGGAGG - Intergenic
951006805 3:17626627-17626649 GCAGAAAGACTTCACAGAGGGGG + Intronic
952874429 3:37931453-37931475 ACACAGAGAAGACACAGAGGGGG - Intronic
956765142 3:72478524-72478546 ACAAATAGATGACACAGAGAAGG + Intergenic
958261911 3:91391883-91391905 AAACACATACTACATAGAGGTGG + Intergenic
958703332 3:97621217-97621239 ACACATGGACAACACATAGAAGG + Intronic
960419170 3:117422627-117422649 ACAAATATACTACATAGTGGAGG - Intergenic
963784845 3:149523855-149523877 CTACAAAGACTTCACAGAGGTGG + Intronic
963814162 3:149811878-149811900 ACTCATAGGATACACAGAAGAGG + Intronic
965976568 3:174631296-174631318 TCACATAGACTACAGTGAGAAGG - Intronic
966460156 3:180167550-180167572 ACACACAGACAACACAGGGTGGG + Intergenic
971045207 4:22798300-22798322 ACACATGGGGTACAAAGAGGTGG - Intergenic
972590567 4:40482104-40482126 ACATATAGAATACACAGAAATGG + Intronic
977054689 4:92176597-92176619 ACACAAAGAGTACACAGAGTTGG - Intergenic
978907245 4:114021104-114021126 AAACGTAGAATCCACAGAGGAGG + Intergenic
979042931 4:115821698-115821720 ACACATAGACTAAAAATAAGGGG - Intergenic
979344702 4:119573476-119573498 ACACATAGGCAATACAGAAGAGG - Intronic
980280837 4:130717253-130717275 ACACAGTGACAAAACAGAGGAGG - Intergenic
980986923 4:139704577-139704599 ACACATAGAGTAGCCAGAGAAGG + Intronic
981286761 4:143026716-143026738 ACTCTTAGACCACAAAGAGGGGG + Intergenic
981325641 4:143444231-143444253 AGACAGAGACTAGACAGAGATGG - Intronic
984191746 4:176613953-176613975 ATACATGGACAACACAGTGGTGG - Intergenic
989127663 5:38072891-38072913 ACAGATAGAATACACAGTGCAGG - Intergenic
990635038 5:57715892-57715914 ACAAAAAGTATACACAGAGGAGG + Intergenic
991550835 5:67834117-67834139 AGACATTGATTACACAGAGAGGG - Intergenic
993638560 5:90374756-90374778 TCACATAGAGTTCACTGAGGAGG + Intergenic
996603440 5:125293092-125293114 TCACAGACACTAGACAGAGGAGG + Intergenic
997197782 5:131991110-131991132 ACACATGGACTACACACACCTGG + Intronic
997637350 5:135423403-135423425 AAAAATAGAGTACAAAGAGGCGG - Intergenic
999945574 5:156591670-156591692 ACACATAGACTACACAGAGGGGG + Intronic
1001839178 5:174859035-174859057 ACACATGGAGGACACAGAGAGGG - Intergenic
1004049815 6:12065486-12065508 ACACATAGAATACAGGGATGTGG + Intronic
1004811106 6:19264230-19264252 AAGCATAGCCTACACAGAGAAGG + Intergenic
1006545058 6:34773810-34773832 ACACAGAGAACACAGAGAGGAGG - Intergenic
1007306404 6:40909531-40909553 TCTCATAGACAACATAGAGGTGG + Intergenic
1008993250 6:57628256-57628278 AAACACATACTACATAGAGGTGG - Intronic
1009181859 6:60527345-60527367 AAACACATACTACATAGAGGTGG - Intergenic
1019794308 7:3038542-3038564 ACACAGAAACCACACAAAGGAGG + Intronic
1023193050 7:37603527-37603549 ACACACAGACTGCACTCAGGTGG + Intergenic
1024297201 7:47854281-47854303 CCACATAGACTAAACACACGGGG + Intronic
1024371175 7:48586003-48586025 ACACATATAATACACAGAAGAGG + Intronic
1024737584 7:52322711-52322733 ACACATGGACTACAGAGAAAGGG + Intergenic
1027515030 7:79131113-79131135 ACACAAAGTCTTCATAGAGGAGG + Intronic
1028108079 7:86904119-86904141 ACACATTGACTTTACAGAGCAGG - Intronic
1028427643 7:90707781-90707803 AAAAAAAGACTTCACAGAGGAGG - Intronic
1030133678 7:106224999-106225021 CCACCTAGACCACACAGAGTGGG + Intergenic
1030577082 7:111301761-111301783 AGAAATAGCCTACACAGATGTGG - Intronic
1034833437 7:154329983-154330005 ACACATGGACGACACAGGGAGGG + Intronic
1035229697 7:157457568-157457590 AAACATAGACTCCAAAGCGGGGG + Intergenic
1035383233 7:158453493-158453515 CCACAGGGGCTACACAGAGGAGG + Intronic
1042970558 8:74403679-74403701 ACACATACACTACAGAGACCCGG - Intronic
1044488817 8:92787883-92787905 GTACATAGAGGACACAGAGGGGG + Intergenic
1045653469 8:104364283-104364305 ACACATACACTACTCACAGCCGG - Intronic
1045998657 8:108393747-108393769 ACACAGAGATTATGCAGAGGCGG + Intronic
1047554652 8:125916050-125916072 ACACACACACTTCACAGAAGAGG - Intergenic
1048318210 8:133377423-133377445 ACACAGAGACTGCAGACAGGAGG + Intergenic
1048375165 8:133816882-133816904 AAACAAAGACAACACAGAGCAGG - Intergenic
1048768757 8:137872045-137872067 ACACATTTACTGCAAAGAGGAGG + Intergenic
1048979660 8:139696614-139696636 ACCCACTGAGTACACAGAGGAGG + Intronic
1049698171 8:143993794-143993816 ACAGATGGACTGCACAGAGCTGG - Intronic
1050152289 9:2628749-2628771 AAAGATAGACTACACAGGGAGGG + Intronic
1052463036 9:28791345-28791367 ACAGAATGAATACACAGAGGTGG - Intergenic
1054144709 9:61553982-61554004 AAACAAAGACTACAGAGGGGAGG + Intergenic
1054464399 9:65484939-65484961 AAACAAAGACTACAGAGGGGAGG + Intergenic
1054719148 9:68586083-68586105 ACACATATATTACACAAATGGGG - Intergenic
1054754138 9:68939931-68939953 CCACATAGACTCCAGAGAGATGG + Intronic
1055166927 9:73208111-73208133 ACAGATAGACACCACAGATGTGG - Intergenic
1056342413 9:85650355-85650377 ACACATTGAATAGACTGAGGAGG - Intronic
1059040368 9:110808150-110808172 ACACATAGACCACGCAGAAAAGG - Intergenic
1060317519 9:122526549-122526571 ACACACAAACAACGCAGAGGTGG + Exonic
1060325274 9:122608596-122608618 ACAGAGAGACTACAGAGAGGTGG - Intergenic
1060396178 9:123318619-123318641 ACAAATGGATTACACAAAGGTGG + Intergenic
1186082330 X:5946532-5946554 ACACATAGGAAACAGAGAGGGGG + Intronic
1188290290 X:28379430-28379452 ACAAATGGAATACACTGAGGAGG - Intergenic
1189148694 X:38682700-38682722 ACACATAGACAAACCAGAGTGGG + Intronic
1194533575 X:95079052-95079074 ACACATTCAATACACAGAGAGGG + Intergenic
1195828638 X:109031187-109031209 ACACATAGACTAGAAACAGAGGG - Intergenic
1197391711 X:125875367-125875389 ACACATAGGCTAAAAAAAGGGGG - Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1198035621 X:132798430-132798452 AATCATAAACTACAAAGAGGCGG - Intronic
1199135326 X:144243570-144243592 ACACATGGCCTACAAAGAGAGGG - Intergenic
1200068593 X:153517083-153517105 ACACAGAGACTGCACACAGGTGG - Intergenic
1200296965 X:154929652-154929674 ACAGATAGACTACAATGAGAAGG - Exonic