ID: 999950138

View in Genome Browser
Species Human (GRCh38)
Location 5:156640197-156640219
Sequence TGATAGTAAGATTTCATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999950138 Original CRISPR TGATAGTAAGATTTCATGGG AGG (reversed) Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
904065871 1:27750349-27750371 AGGTAGTCAGATTACATGGGGGG + Intronic
906300424 1:44677697-44677719 TGATAGAAAGACTTGAGGGGAGG + Intronic
908398379 1:63746950-63746972 TGGTAGTAAGTTTGCATCGGAGG - Intergenic
908537731 1:65093589-65093611 TGGTATTAAGATTTCATTAGAGG - Intergenic
909491727 1:76233908-76233930 TGATATTAAAATTTTATGTGGGG + Intronic
910756712 1:90701606-90701628 TAATAGCAAGATTTCATGCAAGG + Intergenic
913277666 1:117154837-117154859 TGATAGTAATATACCATTGGCGG - Intronic
915958474 1:160243538-160243560 TGATAGAGAGATTACATGGCTGG - Intronic
917236425 1:172897533-172897555 TGAATTTAAGATTTCATGGGTGG - Intergenic
917759776 1:178143117-178143139 TGATATTAAAATTTAATGGTGGG - Intronic
920649274 1:207824623-207824645 TGATAGAAGGATCTCATGTGTGG - Intergenic
921025330 1:211274061-211274083 TTTTTGTAACATTTCATGGGAGG + Intronic
924264951 1:242271995-242272017 TGATATTATAATATCATGGGAGG + Intronic
1063087761 10:2835103-2835125 ACATATTAATATTTCATGGGTGG + Intergenic
1063292398 10:4762735-4762757 AGATATTAATATTCCATGGGAGG + Intergenic
1066161715 10:32739965-32739987 TGGTGATAAGATGTCATGGGAGG + Intronic
1066719861 10:38326495-38326517 TGATATTATAATATCATGGGAGG - Intergenic
1068089818 10:52419706-52419728 TGAAAGGAATATTTCAAGGGAGG - Intergenic
1070674847 10:78405515-78405537 TGAGAGTCTGTTTTCATGGGAGG + Intergenic
1071344156 10:84675453-84675475 TGTTAATAAGATTTGGTGGGAGG + Intergenic
1073674446 10:105629789-105629811 TGGTATTAAAATTTCATGGAGGG + Intergenic
1075579410 10:123605747-123605769 TGACAATAGGTTTTCATGGGAGG + Intergenic
1076161459 10:128247255-128247277 TAATAATAAGATTTCATGGCTGG + Intergenic
1076615657 10:131752479-131752501 TGAAAGTTAAATTTCAGGGGGGG + Intergenic
1078317290 11:10304474-10304496 AGCTAGTAAGATTTCACGGTAGG - Intergenic
1079425489 11:20338140-20338162 TGCTAGTAAGATCTCCTGAGAGG + Intergenic
1080114124 11:28602862-28602884 TAATACTAAGATATCATGGGTGG + Intergenic
1080804999 11:35644698-35644720 GGATTGTAAGATTTCATGATTGG - Intergenic
1081293496 11:41355991-41356013 TGATAATAAGTTTTCATTAGTGG + Intronic
1081880355 11:46445160-46445182 TGATATTAAAATTTCATGGGAGG + Intronic
1085548074 11:77339390-77339412 TGATATTACAATTTCATGGCAGG + Intronic
1086895081 11:92302792-92302814 TGTTAATAAGATTTCAAGGAAGG + Intergenic
1090375049 11:126282744-126282766 TGTTAGGAAGATTAAATGGGCGG + Intergenic
1090455235 11:126843375-126843397 AGTGAGTGAGATTTCATGGGAGG + Intronic
1090824921 11:130378296-130378318 AGATAATAAGATTTCAGGGAGGG - Intergenic
1092133516 12:6129371-6129393 GCATAGTAAGATTTTAAGGGAGG + Intergenic
1093360564 12:18221707-18221729 TGATAGTAAGATATGATTGTGGG - Intronic
1094662059 12:32479449-32479471 AAATAGTAAGAATTCATGGGAGG - Intronic
1109681393 13:65757159-65757181 TGGTGGAATGATTTCATGGGAGG + Intergenic
1109842889 13:67944067-67944089 TGCTGGTAAGATTTCAAGGTTGG + Intergenic
1111121956 13:83864450-83864472 AGACAGTAAGATTTCAAAGGGGG - Intergenic
1112069935 13:95838529-95838551 TTATAGTAAGACTTCAAGTGTGG - Intronic
1112205474 13:97319667-97319689 TGATATTAAAATTGCATGGAGGG - Intronic
1121943875 14:98100095-98100117 TGATATTATGTTTTCATGGATGG - Intergenic
1124959266 15:34382689-34382711 TGGAAGTAATATTTCATGTGAGG + Intronic
1124975892 15:34528910-34528932 TGGAAGTAATATTTCATGTGAGG + Intronic
1125163635 15:36677285-36677307 TGGCATTAAAATTTCATGGGGGG + Intronic
1125809187 15:42522385-42522407 TAATATTAATTTTTCATGGGAGG + Intronic
1127373073 15:58358192-58358214 TGAGAGTAAGATTGGATGGGAGG - Intronic
1131372964 15:91898807-91898829 TAGTATTAAAATTTCATGGGGGG + Intronic
1136021215 16:27441402-27441424 TAACAGCAAGCTTTCATGGGCGG - Intronic
1139963526 16:70731573-70731595 TAAAAGTAAGAATTCATGGTGGG + Exonic
1142017762 16:87760175-87760197 TGAAAGTCAGATTTCATGTCAGG - Intronic
1146497851 17:33338727-33338749 TGACATTAAAATTTCTTGGGTGG + Intronic
1146817825 17:35957964-35957986 TTATAGTAAGCTTCAATGGGTGG + Intergenic
1149205464 17:54239731-54239753 TGATAGTTTGGTTTCATGGGAGG + Intergenic
1150839997 17:68599234-68599256 TCAAAGTAAGATGTCATCGGTGG - Intronic
1150959612 17:69899500-69899522 TTATATTACAATTTCATGGGAGG + Intergenic
1151517896 17:74608335-74608357 TGGTATTAACATTTCATGAGGGG + Intergenic
1152125483 17:78444222-78444244 TGAAAGTAAGATGTCAAGTGTGG - Intronic
1155624161 18:27815228-27815250 AGATAGTGAGATTTCAGGGAAGG + Intergenic
1155852105 18:30786730-30786752 TGATAGTGAAATTTTTTGGGGGG + Intergenic
1158796686 18:60855067-60855089 TGATAGGAAGACTACCTGGGTGG - Intergenic
1160149660 18:76389370-76389392 TGAGAATGAGATTTCAGGGGAGG + Intronic
1165793270 19:38504935-38504957 AGAGAGGAAGATTTCAGGGGTGG + Intronic
1167226644 19:48247940-48247962 TCATAGTAAAATTTGATGAGTGG - Intronic
927968688 2:27289680-27289702 TGATATTAATATTTAATGAGGGG + Intronic
929012562 2:37459831-37459853 TGATAGTAAAAGGTCATTGGTGG + Intergenic
929455621 2:42062764-42062786 TGCTATTAAAATTTCATGGAAGG + Intergenic
929978772 2:46659229-46659251 TGGTATTAAAATTTCATGGCAGG - Intergenic
932084369 2:68745289-68745311 TGAAAGTGAGATTTCAGAGGTGG - Intronic
933276588 2:80290619-80290641 TGGTATTAAGATTTCAGGGAGGG - Intronic
935615714 2:105079021-105079043 TGGTATTAACATTTCATGCGGGG + Intronic
942144545 2:173013957-173013979 TGATACAAAGAGTGCATGGGTGG - Intronic
942286340 2:174421021-174421043 TCATAGTAAGATTTCTGAGGGGG + Intronic
942668604 2:178349479-178349501 TGATAGAAAGATTAAATGGTTGG + Intronic
942704736 2:178757759-178757781 AGACAGTCAGATTTCATGCGAGG - Exonic
942913407 2:181273581-181273603 TCATAGTAAAATATCATAGGTGG - Intergenic
942930273 2:181483877-181483899 TGAGATTAAGATTTCAATGGGGG - Intronic
944677326 2:202044574-202044596 TGTTAGTTAGATATCATGGAGGG + Intergenic
944846837 2:203677433-203677455 TGATATTAAAATTTTGTGGGGGG + Intergenic
946159187 2:217825761-217825783 TGATGGCAAGATTGCATGGAGGG + Intronic
1169097856 20:2919310-2919332 TGATAGTAAGGTTTAAAGGGAGG - Intronic
1169259357 20:4124528-4124550 TTATAATAACATTGCATGGGTGG + Intronic
1170051375 20:12149421-12149443 TTAGAGCTAGATTTCATGGGTGG - Intergenic
1170209868 20:13837663-13837685 AGATAATAAGATAACATGGGAGG + Intergenic
1170833566 20:19864096-19864118 TGGTATTAAGATTTAATGGAGGG + Intergenic
1170961968 20:21033591-21033613 TGTTAGAAACACTTCATGGGTGG - Intergenic
1171156669 20:22880742-22880764 TGAGAATAAGCTTTCATGGGAGG + Intergenic
1173960251 20:47065463-47065485 TAATAGTAAAATTTCATGGGAGG + Intronic
1176712117 21:10159943-10159965 TGATTTTAAGTTTTCATGGAGGG + Intergenic
1181612481 22:24026875-24026897 TGACAGAAAGATTTAATGGAAGG - Intronic
1182064842 22:27423369-27423391 TGCTATTAAAATTTCATTGGTGG + Intergenic
1182384670 22:29927718-29927740 TGATAGTAACATTCCTTGGATGG + Intronic
949976507 3:9465888-9465910 TTATAGTAAGGTATCATGAGAGG + Intronic
952287542 3:31982534-31982556 TTCCAGGAAGATTTCATGGGTGG + Intronic
952761429 3:36917863-36917885 TGGTATTAAAATTTCATAGGGGG + Intronic
954972250 3:54661081-54661103 TGAAAGTAAGATGTCGAGGGAGG + Intronic
957876190 3:86149342-86149364 AGATAGTCAGATTTCTTTGGGGG + Intergenic
962858121 3:139368652-139368674 TGGTATTAAAATTTCATTGGGGG - Intronic
963748299 3:149148356-149148378 GGAGAATAGGATTTCATGGGGGG - Intronic
964926522 3:161964433-161964455 TGATCCTAACATGTCATGGGAGG + Intergenic
964934810 3:162070647-162070669 TGAAAGTAAGATTTAAAGGCAGG - Intergenic
967222519 3:187259482-187259504 TGATATTAAAATTTCATGGTGGG + Intronic
972060416 4:34863968-34863990 TGATAGAAAGATTTGCTGGTGGG + Intergenic
972071216 4:35020789-35020811 TGATAGAAAGATTTTAGGGTGGG + Intergenic
972295563 4:37734534-37734556 TGGTAATAAGATTTCAGTGGAGG - Intergenic
973016954 4:45152175-45152197 TAATTTTAAGTTTTCATGGGAGG - Intergenic
973026103 4:45273720-45273742 TGAAAATTAGATTTCATGGAAGG + Intergenic
976991148 4:91368060-91368082 TGATAGTATTTTTCCATGGGTGG + Intronic
977657925 4:99544227-99544249 TGACACAAAGATTTCATGGCTGG + Intergenic
980676062 4:136082968-136082990 TGAAACCAAGATTTAATGGGTGG + Intergenic
981363658 4:143876021-143876043 TGATGTTAAGAATTCATGGGTGG + Intronic
981374401 4:143996814-143996836 TGATGTTAAGAATTCATGGGTGG + Intronic
981384722 4:144116125-144116147 TGATGTTAAGAATTCATGGGTGG + Intronic
981600001 4:146476657-146476679 TAATAGTAAGATTTGATCTGAGG - Intronic
981754571 4:148128199-148128221 TGATGGTAAGATAGCATGGGTGG - Intronic
983250964 4:165345966-165345988 GGATAATAATACTTCATGGGCGG + Intergenic
990423469 5:55660782-55660804 TGGTATTAAAATTTCATGGGGGG + Intronic
992063691 5:73083963-73083985 TGATAGTTAGCTTTAATAGGGGG - Intronic
993301541 5:86217174-86217196 GTATAGAAACATTTCATGGGAGG + Intergenic
994228646 5:97286165-97286187 TGATAGTAATAAATCATCGGTGG - Intergenic
995834677 5:116388156-116388178 TGGTATTAAAATTTCATGGGAGG - Intronic
996312730 5:122125088-122125110 TGATACTAAAATTTCATGGTGGG + Intergenic
997971770 5:138408961-138408983 TGGTATTAAAATTTCTTGGGTGG + Intronic
999950138 5:156640197-156640219 TGATAGTAAGATTTCATGGGAGG - Intronic
1001311548 5:170614488-170614510 TGGTATTAAAATTTCATGGTTGG - Intronic
1001441065 5:171743437-171743459 TCATAGGAACATTTCATGGGGGG - Intergenic
1003047015 6:2743089-2743111 TGGTATTAAAATTTAATGGGAGG + Intronic
1006106224 6:31718583-31718605 TGAGAGTATTATTTCCTGGGAGG + Intronic
1009951504 6:70402052-70402074 TGAGAGTAAAATTTCCTTGGTGG - Intergenic
1012020520 6:93912720-93912742 TCATACTAAGATTGCAAGGGGGG - Intergenic
1016773504 6:147878374-147878396 TGATAGTAAAACTTCATGAATGG - Intergenic
1017792253 6:157811677-157811699 TGATCCTAAGATTTCATGCTTGG + Intronic
1018489574 6:164278504-164278526 TGATAGTGAGTTCTCATGGCTGG + Intergenic
1021607122 7:22419305-22419327 TGATAGCAAGATTTCACAGTGGG - Intergenic
1022360601 7:29653114-29653136 TGATATTAAGATTCCAAGAGAGG + Intergenic
1022474940 7:30703798-30703820 TGGTATTAAAATTTCATGGTAGG - Intronic
1024463876 7:49688271-49688293 TGCTTGTAAGAATTCATGTGTGG - Intergenic
1024728404 7:52227579-52227601 TAATAGAAAGATTTTGTGGGAGG + Intergenic
1024799965 7:53065284-53065306 TGATCTAAAGATTTCATGGTAGG - Intergenic
1027340627 7:77203878-77203900 TGAAAGTAAAATTTCATATGCGG - Intronic
1028953707 7:96665313-96665335 TGTTAGTGGGATTTCAGGGGAGG + Intronic
1032512019 7:132480029-132480051 TAATAGTATGATTGAATGGGAGG - Intronic
1033050046 7:137995907-137995929 TGATAGTAACATTGGTTGGGAGG - Intronic
1033128225 7:138723454-138723476 TTCTAGAATGATTTCATGGGAGG + Intronic
1033178237 7:139147511-139147533 GTATATTAAAATTTCATGGGAGG - Intronic
1035345630 7:158195726-158195748 AGACAGGAAAATTTCATGGGTGG - Intronic
1035636690 8:1152578-1152600 TGATGGAATGATGTCATGGGGGG + Intergenic
1036422569 8:8611967-8611989 TGATATTAAAATGTCATTGGAGG - Intergenic
1037544056 8:19900352-19900374 TGGTATTAAAATTTCATGGGTGG + Intergenic
1039161747 8:34629202-34629224 TGGTAGAAAGCTTTCATAGGAGG + Intergenic
1039429176 8:37512162-37512184 TGTTAGTAAGATTTCATGTGGGG + Intergenic
1043002952 8:74781859-74781881 TGATAGTAGGATTTCCTTTGAGG + Intronic
1044351464 8:91171276-91171298 TAATACTAAAATTTCATGGGGGG - Intronic
1046362668 8:113183341-113183363 TCCTAGTAAGTTTTCAGGGGTGG - Intronic
1046862320 8:119107198-119107220 TAATGGTGACATTTCATGGGAGG + Intergenic
1047695171 8:127396242-127396264 TGATGGTAAAATTTCATGATGGG - Intergenic
1049853597 8:144848047-144848069 TGAAATTAAAATTTCATGGCTGG + Intronic
1051089862 9:13393685-13393707 GGATATTAAGATTTCATGGGGGG - Intergenic
1051982703 9:23043086-23043108 AGAAAATATGATTTCATGGGTGG + Intergenic
1052323771 9:27195414-27195436 TGGTATTAAAATTTCACGGGAGG - Intronic
1053455551 9:38230810-38230832 TGATAGTCACATTTCAGGGTGGG + Intergenic
1053756633 9:41318228-41318250 TGATTTTAAGTTTTCATGGAGGG - Intergenic
1055449038 9:76414320-76414342 TGCTGGTAAGATTTGAGGGGAGG + Intergenic
1058658778 9:107249605-107249627 TGATATTAAAATTTCATAGAGGG + Intergenic
1059726758 9:117015979-117016001 TGGTATTAAAATTTCATGGGTGG - Intronic
1059986872 9:119828898-119828920 GGATAGTTATTTTTCATGGGGGG + Intergenic
1060204291 9:121673581-121673603 TGATATTAAAATTTTATGGAGGG + Intronic
1202796872 9_KI270719v1_random:128932-128954 TGATTTTAAGTTTTCATGGAGGG + Intergenic
1187367891 X:18679471-18679493 TGCTAGTAAGATTACACTGGGGG - Intronic
1188504339 X:30865206-30865228 TGCTACTGAGATTTTATGGGCGG - Intronic
1189925404 X:45948120-45948142 TGGTAGTGATCTTTCATGGGTGG - Intergenic
1190020978 X:46875131-46875153 GGATACTAAGATTTAATGGTTGG + Intronic
1190834511 X:54087974-54087996 TAATAGTAATATTTCATCTGTGG - Intronic
1192086783 X:68106575-68106597 TGGTAGTAAGATTGCCAGGGAGG + Intronic
1192258624 X:69489092-69489114 TGATTTTAAAATTTAATGGGCGG - Intergenic
1194555227 X:95350092-95350114 TGATAGTCAGTTTTTTTGGGGGG - Intergenic
1195168764 X:102246151-102246173 TGATAGTATTATTAGATGGGTGG + Intergenic
1195190093 X:102440936-102440958 TGATAGTATTATTAGATGGGTGG - Intronic
1197555201 X:127944636-127944658 TGAAAGTCAGAGTTAATGGGGGG + Intergenic
1198227705 X:134661009-134661031 TGGTATTAAAATTTAATGGGGGG - Intronic
1198938224 X:141922414-141922436 TGATTGTATGATTTCTTGAGTGG + Intergenic
1199272250 X:145898285-145898307 TGACAGGGAGATGTCATGGGGGG + Intergenic