ID: 999951802

View in Genome Browser
Species Human (GRCh38)
Location 5:156659069-156659091
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 11, 1: 14, 2: 10, 3: 28, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999951802 Original CRISPR GTTTCCAGTTACAATGTGAC TGG (reversed) Intronic
900489890 1:2942624-2942646 GTTGCCAGTTACAATGCCAAGGG + Intergenic
901308731 1:8252521-8252543 GTTTGCAGATGCAATGTTACTGG - Intergenic
901447193 1:9315825-9315847 GTTTCCAGTAACTATGTGGGTGG + Intronic
901930734 1:12595202-12595224 GTTTCCAATAACAAAGTGCCCGG + Intronic
901978427 1:13013834-13013856 TTTTTCAGTTACAGTATGACTGG - Intronic
902003656 1:13215104-13215126 TTTTTCAGTTACAGTATGACTGG + Intergenic
902022880 1:13360843-13360865 TTTTTCAGTTACAGTGTGACTGG + Intergenic
902277183 1:15348358-15348380 GTTTCCAGTCACCATGAGAAGGG - Intronic
905096392 1:35474892-35474914 GTTTCCAGTTATAAAGGAACTGG - Exonic
905227708 1:36490324-36490346 GTTTCCAGTTACAGTGTGACTGG - Intergenic
906890799 1:49711138-49711160 GTTTCCAGTGAAAATGTAAAAGG + Intronic
909413747 1:75382073-75382095 GTTTCCAGTTACAATGTGACTGG + Intronic
909696639 1:78474930-78474952 GTTTCCAGATACAGTGTGCAGGG + Intronic
912372190 1:109182405-109182427 GTATCTACTTACAATGTGCCAGG + Intronic
912789049 1:112633177-112633199 GTATACAGTTACAGTGAGACTGG - Intronic
913419385 1:118648259-118648281 CTTTCCAGTCACATTGTGTCCGG - Intergenic
915401897 1:155628029-155628051 GTTTCCAGTTACAATGTGACTGG - Intergenic
916010197 1:160698631-160698653 ATTTCCAGTTACAGTGTGACTGG + Intronic
916630432 1:166606751-166606773 TTTTTCAGTTACAGTGTCACTGG - Intergenic
918130781 1:181627212-181627234 TTTACCACTTACAATGTTACAGG + Intronic
918173971 1:182026988-182027010 GGTTCCAAATGCAATGTGACTGG + Intergenic
919463084 1:197902164-197902186 GTTTCCAGGTAGTATGTGATAGG - Intergenic
919940102 1:202280626-202280648 GTTTCCAGGAACAAACTGACTGG - Intronic
920629362 1:207636465-207636487 GTTTCCAGTTACAGTGTGACTGG - Intronic
923936262 1:238763684-238763706 TTTTTCAGTTACAGTGTGACTGG - Intergenic
924429733 1:243986696-243986718 CTTTCCAGTGAAAATGTGAGAGG - Intergenic
1063530420 10:6825542-6825564 GTTTCCAGTTACAGTGTGACTGG - Intergenic
1064684928 10:17850735-17850757 GTTTCCAGGCACTATGTGTCAGG - Intronic
1065035373 10:21633231-21633253 GTTTTCAGTTAATATGTGCCAGG - Intronic
1066329319 10:34401959-34401981 GTTTCTTGCTACAATGTGAAAGG + Intronic
1067285583 10:44905420-44905442 GTTTCAAGTTACCAGGTGTCAGG - Intergenic
1067529902 10:47062716-47062738 TTTTCCAGTTTAAATGTCACGGG + Intergenic
1069529114 10:69202509-69202531 GTTTCCACTTACAATGAGATTGG - Exonic
1069761016 10:70811500-70811522 GCTTCCAGCAACAATGTGAGAGG + Intergenic
1071561707 10:86650718-86650740 ATTTCCTGATACAATGTGTCAGG + Intergenic
1073790559 10:106936225-106936247 GTTTCCATTTACATCCTGACTGG + Intronic
1075246408 10:120825900-120825922 TTATACAGTTACAAAGTGACAGG - Intergenic
1077585517 11:3448845-3448867 TTTTTCAGTTACAGTGTGACTGG - Intergenic
1079899932 11:26170003-26170025 CTTGCCAGTTACAATATCACTGG - Intergenic
1081291129 11:41327241-41327263 GTTTCCAATTACAATGTAGTTGG + Intronic
1083393126 11:62369843-62369865 GTTTCCAGTTACAGTGTGACTGG - Intronic
1083868646 11:65472927-65472949 GTTAGCAGTTACAAAGTGGCTGG + Intergenic
1084830432 11:71764684-71764706 TTTTTCAGTTACAGTGTGACTGG + Intergenic
1085588747 11:77737052-77737074 GTTTCTATTTACAATGAGCCAGG - Intronic
1085840215 11:80002872-80002894 GTGTGCATTTACTATGTGACAGG + Intergenic
1087724565 11:101703143-101703165 GTTTCCAGTTACAATGTGACTGG + Intronic
1092588507 12:9925757-9925779 GTTTCCTGTTACTATCTGAGAGG - Intronic
1094874064 12:34620928-34620950 GTTTCCAGTTATAGTGTGACTGG - Intergenic
1096562299 12:52445075-52445097 GTTTACAGTTAAAATGTGCATGG + Intergenic
1097330614 12:58328822-58328844 GTTTCCAGTTACAGTGTGACTGG - Intergenic
1098640649 12:72835065-72835087 TTTTCCAGTAACACTATGACTGG - Intergenic
1100249837 12:92807409-92807431 GTTTACATTCACAATGTTACTGG + Intronic
1105469402 13:20679162-20679184 GAATGCAGTTACAATGTGATTGG - Intronic
1110291416 13:73811371-73811393 GTTACCATTTATTATGTGACTGG + Intronic
1112981411 13:105388962-105388984 ATTTCCAGTTGCAATTTGATAGG - Intergenic
1118981085 14:70717674-70717696 GGTCCCAGTTGCAGTGTGACTGG - Intergenic
1119599323 14:75964221-75964243 GTTTCCTCTTAAAATGTGAATGG + Intronic
1119632434 14:76244766-76244788 GTATCCAGTTATAATCTGAAGGG + Intronic
1123899911 15:24865859-24865881 GTTTCCAGTCATGATGGGACAGG - Intronic
1132262576 15:100439850-100439872 GTTTCCAATTGCAGTTTGACAGG - Intronic
1133129677 16:3669048-3669070 GGTTCCAGGTACAATGTCCCTGG - Intronic
1136930459 16:34413412-34413434 GTTTCCAGTTACAGTGTGACTGG - Intergenic
1136974115 16:34998396-34998418 GTTTCCAGTTACAGTGTGACTGG + Intergenic
1138737174 16:59264053-59264075 GTCTCCTGTTAAAATGTCACAGG + Intergenic
1138737383 16:59266081-59266103 TTTTTCAATTACAATATGACAGG - Intergenic
1140658788 16:77167311-77167333 GTTTCCAGTGACAATGGAGCAGG + Intergenic
1146714515 17:35073418-35073440 GTTTCCAGGTAAGATGTGACAGG + Intronic
1147059357 17:37862226-37862248 TTTTCCAGTTACAAAGTTCCAGG - Intergenic
1147836488 17:43336054-43336076 GTATGCAATTACAATGTGATTGG - Intergenic
1147836940 17:43339806-43339828 GTATGCAATTACAATGTGATTGG - Intergenic
1148408636 17:47444728-47444750 TTTTCCAGTTACAAAGTTCCAGG - Intergenic
1148508019 17:48143638-48143660 TTTACGAGTTACAATGTGAGAGG - Intronic
1149608418 17:57941222-57941244 TTTTCCAGTTAAAATGAAACAGG - Intronic
1151874667 17:76860591-76860613 GTTTACAGGCACACTGTGACCGG + Intergenic
1152213694 17:79019778-79019800 GTTTTCAGTTACATGGAGACAGG - Intergenic
1153014105 18:567764-567786 GATTCCAGTTACTATATTACTGG - Intergenic
1153481378 18:5550607-5550629 GTTTCCAGTTAGAATGTTTAAGG + Intronic
1155052166 18:22158008-22158030 ATTTACAGTTCCAATGTGAGGGG + Intergenic
1155097061 18:22566543-22566565 GTGTCCAGCTACAAGGTGGCTGG + Intergenic
1157345223 18:46823550-46823572 GTTTCATGTTACTAAGTGACAGG - Intronic
1160416361 18:78714306-78714328 GTTTCCACTGAAAATGTGTCTGG - Intergenic
1160675079 19:386262-386284 ATTTCCAGTTACAGTGTGACTGG + Intergenic
1163920626 19:20285334-20285356 ATTTCCAGTTACAGTGTGAATGG + Intergenic
1164154258 19:22580374-22580396 ATTTCCAGTTACGATGTGACTGG + Intergenic
1164370449 19:27638980-27639002 GTTTCCAGTTACAATGTGACTGG - Intergenic
1165397419 19:35572833-35572855 GTTTCCAGTTACAGTGTGACTGG - Intergenic
1165606344 19:37107994-37108016 ATTTCCAGTTACAGTGTGACTGG - Intronic
1167991292 19:53363384-53363406 ATTTCTGGTTACACTGTGACTGG + Intergenic
1168500480 19:56888625-56888647 GTTTCCAGCTGCAATGGGAAGGG - Intergenic
1168571797 19:57476748-57476770 CTACCCAGTTACAATGTGCCTGG + Intronic
928334765 2:30387738-30387760 GGTTCCTGATACAATGTTACAGG - Intergenic
930755888 2:54971675-54971697 GTTTTCTGTAACCATGTGACTGG + Exonic
930807025 2:55500963-55500985 GTTTTCAGTTCCACTGTGGCAGG - Intergenic
930846205 2:55907112-55907134 GTTTCCAGTGTTAATGTTACAGG + Intronic
933860892 2:86466479-86466501 GTCTCCAGTTCCAATCTGAGAGG - Exonic
934878516 2:97951122-97951144 TTTTCCTGTTACAATATGTCTGG - Intronic
935612448 2:105038959-105038981 GTTACCATTTACAAGGTAACAGG - Intronic
938270200 2:129963321-129963343 GTTTCCAGTTACAGTGTGACTGG - Intergenic
940057413 2:149527205-149527227 ATGTCCAGTTACTATGTGACAGG - Intergenic
941245653 2:163092756-163092778 GTTTTCAGTTTCAATGTCTCTGG - Intergenic
943184137 2:184584520-184584542 GCTAACAGTAACAATGTGACAGG - Intergenic
944311521 2:198238925-198238947 GCTTCCAGTTTCCATGTAACAGG + Intronic
1172163125 20:32882304-32882326 GTTTACAGTTTCAAAGTGAATGG - Intronic
1172338353 20:34135177-34135199 GTTTTCAGTTACACTGTGACTGG + Intergenic
1172605960 20:36214261-36214283 CCTCCCAGTTACAAAGTGACAGG - Intronic
1173715502 20:45200035-45200057 GTTTGCAGTCACAAGGTGACTGG + Intergenic
1180838549 22:18946467-18946489 GTTTCCAGTTACAATGTGACTGG + Intergenic
1181536049 22:23545860-23545882 TTTTTCAGTTACGATGTGACTGG + Intergenic
950030481 3:9849041-9849063 GTTTCCAGTTACAATGTGACTGG - Intronic
950677298 3:14562129-14562151 GTTGCCAGTTACAAAGGGGCTGG + Intergenic
952939011 3:38426305-38426327 GAATGCAGTTACAATGTGATTGG + Intergenic
957069805 3:75558551-75558573 TTTTTCAGTTACAGTGTGACTGG + Intergenic
957677619 3:83390489-83390511 CTTTCCAATTCCAATGTGGCAGG + Intergenic
957691537 3:83577047-83577069 CTTTCCAGTTTTCATGTGACTGG - Intergenic
957788126 3:84906401-84906423 ATTTCTAGTAACATTGTGACAGG - Intergenic
959070686 3:101699629-101699651 GTTTCCAGTTACAGTGTGACTGG + Intergenic
960027526 3:113025632-113025654 TTTTCCAGTTACAGTGTGACTGG - Intergenic
960264224 3:115602215-115602237 GTGACCAGTTACCATGAGACAGG + Intergenic
961297490 3:125898380-125898402 GTTTCACGTTACAATGTGACTGG + Intergenic
961619721 3:128214137-128214159 GGTTACAGTTACAATGACACTGG - Intronic
962179078 3:133186552-133186574 GTTTCCACTTACAAATAGACTGG - Intronic
964031574 3:152145021-152145043 GTTGGCAGTTCCAATGTGAGTGG - Intergenic
965341047 3:167491679-167491701 TTTTACAGATACAATGTGAATGG + Intronic
965359787 3:167724724-167724746 GGTTCCAGTGATAATGTGGCTGG - Intronic
967025957 3:185563911-185563933 GTTTCCAGTTACAGTGTGACTGG - Intergenic
968011778 3:195286171-195286193 GTTGGCAGTTAAAATTTGACAGG - Intronic
969000702 4:3978765-3978787 TTTTTCAGTTACAGTGTGACTGG - Intergenic
969753312 4:9129927-9129949 TTTTTCAGTTACAGTGTGACTGG + Intergenic
969813222 4:9666105-9666127 TTTTTCAGTTACAGTGTGACTGG + Intergenic
969880430 4:10168915-10168937 GAGTACAGTTACAATGTGACTGG - Intergenic
971018822 4:22514877-22514899 GTTTTCAGTTCCAATGTTCCTGG + Intronic
972812651 4:42607739-42607761 TAATCCAGTTACATTGTGACTGG - Intronic
974921013 4:68238994-68239016 GATTCCAGTTATAATTTTACTGG + Intronic
976562027 4:86512844-86512866 GTTTGCAGTTTCAATGTCCCTGG - Intronic
977261923 4:94807569-94807591 CTCTCCAGTTACAATGTTTCGGG - Intronic
978995243 4:115143446-115143468 TATTCCAGTTAAATTGTGACTGG + Intergenic
981416397 4:144498670-144498692 CTCTCCAGATACAATTTGACTGG + Intergenic
981546171 4:145896115-145896137 GCTTCTATTTACTATGTGACAGG - Intronic
983215797 4:165001517-165001539 GTTTCCAGTTACAATGTGACTGG + Intergenic
983506646 4:168560344-168560366 GTTTCCAGCTGCAGTGTTACTGG - Intronic
984060472 4:174983723-174983745 GAATACAGTTACAATGTGACTGG - Intergenic
985461101 4:190107659-190107681 TTTTTCAGTTACAGTGTGACTGG - Intergenic
985698074 5:1353115-1353137 GTTGACAGTGACAATTTGACTGG - Intergenic
988380078 5:30488008-30488030 GTTTCCAGTTACAGTGTGACTGG - Intergenic
993972722 5:94440045-94440067 AGTTCCAGTTACAACGTGGCTGG + Intronic
996021759 5:118598844-118598866 GTTTGTAGTTACAATGTAATAGG - Intergenic
997401519 5:133607036-133607058 GTTTCCAGATACAATCTTACAGG - Intronic
997893171 5:137693302-137693324 GTTTCCATTTAAAAGGTCACAGG + Intronic
999752274 5:154637373-154637395 TTTTTCAGTTACAGTGTGACTGG - Intergenic
999951802 5:156659069-156659091 GTTTCCAGTTACAATGTGACTGG - Intronic
1002061561 5:176628794-176628816 GTGTCCACTTACTATGTGCCAGG - Intronic
1003775298 6:9354125-9354147 TTTTCCAGATACTTTGTGACAGG - Intergenic
1003775751 6:9361290-9361312 ATTTCCATTTTTAATGTGACTGG + Intergenic
1004339039 6:14791307-14791329 TTTTCTAGTTACAATGTCAATGG - Intergenic
1007150552 6:39686399-39686421 GTTTCCATTTGCCATGTGATTGG - Intronic
1007571562 6:42895051-42895073 TTTTTCAGTTACAGTGTGACTGG - Intergenic
1008217965 6:48818672-48818694 GTTTCCAGTGACAATGTGAGGGG - Intergenic
1008815791 6:55564075-55564097 GTGTTCAGTCACAGTGTGACTGG + Intronic
1009606696 6:65878849-65878871 GTTTACAGTTAAAATAAGACAGG - Intergenic
1010591554 6:77718300-77718322 GTTTCCAGTTACAATGTGACTGG - Intronic
1010649220 6:78431571-78431593 GTTCCCATTTACAAGGTCACAGG + Intergenic
1011748932 6:90435805-90435827 TTTTCCAGTAAAATTGTGACTGG + Intergenic
1012287287 6:97406942-97406964 GTTTCCAGTTACATTTTTAAAGG + Intergenic
1012948566 6:105493491-105493513 GTTTTCAGTTACAGATTGACTGG + Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1017102486 6:150861049-150861071 ATTTTCAGTTACAGTGTGACTGG + Intergenic
1018334855 6:162776237-162776259 GTTTCCATTGACAATGCTACAGG - Intronic
1019976229 7:4583789-4583811 GTTTCCAGTTACAATGTGACTGG - Intergenic
1019977165 7:4592293-4592315 GTTTCCAGTTACAATGTGACTGG - Intergenic
1020051096 7:5082309-5082331 GTTTCCATTTACCATGTGTCTGG + Intergenic
1020978371 7:15036991-15037013 GCTTGCTGTTACAATGTCACTGG - Intergenic
1024475211 7:49801949-49801971 GTTTCCAGTTACGAAGACACTGG - Intronic
1030547258 7:110912069-110912091 GTATCCAGTTATAATGTCAAAGG + Intronic
1036291777 8:7499238-7499260 GTTTCCAGTTACAGTGTGACTGG - Intronic
1036376522 8:8205258-8205280 TTTTTCAGTTACAGTGTGACTGG + Intergenic
1036853014 8:12217880-12217902 TTTTTCAGTTACAGTGTGACTGG - Intergenic
1036874387 8:12460402-12460424 TTTTTCAGTTACAGTGTGACTGG - Intergenic
1038156611 8:24997443-24997465 GTTTCCAGAGAAAATGTTACGGG - Intergenic
1041117226 8:54551685-54551707 GTTTCCAGGTAAAATCAGACTGG - Intergenic
1041667858 8:60463342-60463364 GTTTCCAATTTCAGGGTGACAGG + Intergenic
1048245290 8:132790407-132790429 GTTACCAGTTACACTGCGAGAGG - Intronic
1048947303 8:139461269-139461291 GTTTCCAGTTACAGTGTGACTGG - Intergenic
1049987516 9:965611-965633 GTTTCCAGTTAGCAGCTGACTGG - Intronic
1052385821 9:27822642-27822664 GTATCCTGTTAAATTGTGACAGG + Intergenic
1055101010 9:72465783-72465805 GTTTATACTTACAATGTGCCAGG + Intergenic
1056232488 9:84560865-84560887 GTTTCCAGTGGCAATGTGTAAGG - Intergenic
1057634906 9:96755516-96755538 TTCTACAGTTACAATGTAACTGG + Intergenic
1058758923 9:108110508-108110530 TTTTCCAATTGGAATGTGACAGG - Intergenic
1060766482 9:126297942-126297964 TTTTTCAGGTACAATATGACAGG + Intergenic
1061155196 9:128856036-128856058 TTTTTCAGTTACAGTGTGACTGG + Intronic
1062192567 9:135255447-135255469 GTTTCCAGGTCCAAGGAGACAGG - Intergenic
1186943861 X:14542859-14542881 GTTCCCAGCCACAATGGGACAGG - Intronic
1187385094 X:18841252-18841274 GTTTGCAGTTTCAATGTTTCTGG - Intergenic
1191579250 X:62742094-62742116 TTTTTCAGTTACAATGTGACTGG + Intergenic
1193331630 X:80241097-80241119 GTTCCCAGTTATGATGGGACAGG + Intergenic
1193427879 X:81361867-81361889 GTTTTCAGTAACAATGAGAATGG - Intergenic
1194478977 X:94396684-94396706 GTTTCCTTTTTCAATGTGTCTGG + Intergenic
1198911909 X:141624478-141624500 GTTCACAGATTCAATGTGACAGG - Intronic
1199716917 X:150513149-150513171 GTCTCCCGTTACAATTTGAGTGG + Intronic
1200260035 X:154609811-154609833 TTTTTCAGTTACAGTGTGACTGG - Intergenic
1200752534 Y:6959809-6959831 TTTTTCAGTTACAGTGTGACTGG - Intronic