ID: 999953244

View in Genome Browser
Species Human (GRCh38)
Location 5:156672486-156672508
Sequence GTAAATTCATGGCCAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999953244_999953249 20 Left 999953244 5:156672486-156672508 CCTGGGCCTGGCCATGAATTTAC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 999953249 5:156672529-156672551 TCTGTCTTCACCAAACCCACAGG 0: 1
1: 0
2: 1
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999953244 Original CRISPR GTAAATTCATGGCCAGGCCC AGG (reversed) Intronic
902644826 1:17790931-17790953 GCAAAGTCAAGGCCAAGCCCAGG - Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
903931246 1:26863719-26863741 AAAAGTTCAGGGCCAGGCCCAGG - Exonic
905207000 1:36348610-36348632 GCAAATTTGTGGGCAGGCCCTGG - Intronic
906239025 1:44230089-44230111 ATAAATTTATGGCCAGGACGAGG - Intronic
906253103 1:44326513-44326535 TTAAATTTATTGCCAAGCCCTGG + Intronic
906674437 1:47683029-47683051 GGGACTGCATGGCCAGGCCCTGG - Intergenic
916317706 1:163469038-163469060 GTAACATAATGGCCAGGACCAGG + Intergenic
917528726 1:175813623-175813645 GTAAATTCTGGGCCAGGCATGGG + Intergenic
917627308 1:176859399-176859421 GTGAATTCATGCCCAGGGCAGGG + Intronic
918049806 1:180964342-180964364 CTAAAGTCCTGTCCAGGCCCCGG + Intergenic
918370012 1:183851203-183851225 TTAAATTCAAGGCCAAGCCTTGG - Intronic
923569457 1:235101017-235101039 CAAAATTCATTGCCAGGACCGGG - Intergenic
923658971 1:235942233-235942255 GTAAATACAGGGCCCAGCCCAGG - Intergenic
923841634 1:237678779-237678801 GTATATTCATGGCCATCCCTGGG - Intronic
924622722 1:245676213-245676235 GTATATTCATGCCAAGGCCATGG - Intronic
1064477499 10:15706837-15706859 GTATCTTCATGGCCAGGGTCAGG - Intronic
1068476635 10:57535448-57535470 GTAAATTCCAGGCCAGGCTAAGG - Intergenic
1069201223 10:65618982-65619004 GGAAATTCCTGGTCAGCCCCAGG - Intergenic
1069249159 10:66246136-66246158 GGAAAGTCAGGGCCAAGCCCAGG - Intronic
1070201258 10:74208072-74208094 GCAAAGTCGTGGCCAAGCCCAGG - Intronic
1073654179 10:105394614-105394636 ATAGATTCCTGGCCAGGTCCAGG - Intergenic
1076152128 10:128170923-128170945 TTAAATTCAAGGCCAGGCCAAGG - Intergenic
1077391293 11:2301794-2301816 GGAAAGTCATGGGCAGGACCTGG - Exonic
1081077717 11:38696725-38696747 GTGATTTCATGGGCAGGCCCAGG - Intergenic
1083380491 11:62264451-62264473 GTAAATTCATGCCCTGGCCGAGG - Intergenic
1083490084 11:63009472-63009494 GCTCATCCATGGCCAGGCCCAGG + Intronic
1083647669 11:64182168-64182190 GAAAATTCTGGGCCAGGGCCAGG + Intergenic
1084364414 11:68688203-68688225 GTCAAGTCATGGCCAGGCTTGGG - Intronic
1084469520 11:69348869-69348891 GCAAAGTCAGGGCCAAGCCCAGG - Intronic
1092127865 12:6087651-6087673 GTTAAATCTTGGCCAGGCGCGGG - Intronic
1095121694 12:38426543-38426565 GTAAATTCAAAGTCAGGCCAGGG + Intergenic
1100197379 12:92262350-92262372 ACAAATTCATGGCAAGTCCCAGG + Intergenic
1103961516 12:124611799-124611821 GAACATTCATGTCCAGGCCTGGG + Intergenic
1109633748 13:65085993-65086015 GCAAAGTCAGGGCCAAGCCCAGG - Intergenic
1111412473 13:87894771-87894793 GCAACTTCATGCCAAGGCCCTGG - Intergenic
1116902184 14:50371888-50371910 GCAAAGTTATGGCCAAGCCCAGG + Intronic
1126794300 15:52247405-52247427 CTAAAGGCAGGGCCAGGCCCTGG - Intronic
1128758062 15:70196523-70196545 GTGGATTCCAGGCCAGGCCCGGG - Intergenic
1130824817 15:87533026-87533048 GTGATTTCATGGCCGGGCCCAGG - Intergenic
1131060248 15:89400033-89400055 TCAAGTTCAGGGCCAGGCCCGGG + Intergenic
1133496459 16:6322817-6322839 CTTAATTCAAGGCCAGGCACAGG + Intronic
1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG + Intergenic
1139839002 16:69863019-69863041 GAGAATTCATGGCTAGGCCGGGG - Intronic
1140504256 16:75460582-75460604 GTAAAGTGATGGGGAGGCCCTGG - Intronic
1141923945 16:87154714-87154736 TTCAATTTATGGCCAGGCACAGG + Intronic
1142580807 17:941315-941337 GTGAATTCATGGCTGCGCCCTGG - Intronic
1142580929 17:942170-942192 GTGAATTCATGGCTGCGCCCTGG - Intronic
1144222556 17:13113179-13113201 GTAAATTCCTGCCCATACCCAGG - Intergenic
1144979191 17:19158216-19158238 GTAAAGCCAGAGCCAGGCCCGGG - Exonic
1144989031 17:19220016-19220038 GTAAAGCCAGAGCCAGGCCCGGG + Exonic
1149727077 17:58906945-58906967 GTGAATTGTTGGCCAGGCCCAGG + Intronic
1150658986 17:67059274-67059296 GAAAATGCATGCCAAGGCCCCGG - Intergenic
1150950893 17:69801496-69801518 GCAAATTCAGGGCCAAGCCCAGG + Intergenic
1161068776 19:2250426-2250448 GTGACCTCAGGGCCAGGCCCAGG - Exonic
1162576554 19:11502689-11502711 GGAAATAAAAGGCCAGGCCCAGG + Intronic
1163447840 19:17357956-17357978 GGAGAATCAGGGCCAGGCCCGGG - Intronic
1165106542 19:33473105-33473127 GGAAAGGCGTGGCCAGGCCCTGG - Intronic
1166499484 19:43330231-43330253 ATAAATTTTGGGCCAGGCCCAGG - Intergenic
1168342917 19:55635976-55635998 GTAAATTCAAGGTCTGGCCAGGG + Intronic
926636682 2:15187658-15187680 GTAAATTCATTTCATGGCCCAGG + Intronic
927501153 2:23584204-23584226 CTAATTTCATACCCAGGCCCAGG - Intronic
927750257 2:25662612-25662634 TTATATTCAGGGCCAGGGCCAGG - Intronic
931915719 2:66952871-66952893 GTAAATTTATGCTGAGGCCCAGG + Intergenic
935421217 2:102871205-102871227 GTCAAGACATGGCCAGGCACAGG + Intergenic
935707962 2:105872710-105872732 GTAAATTCATGGCAGAGCCAAGG + Intronic
936476531 2:112844678-112844700 CCAAATACATGGACAGGCCCTGG - Intergenic
939336417 2:140834525-140834547 TTAGATTTATGGCCAGGCGCGGG - Intronic
945720695 2:213415292-213415314 GGAACTCCATGGCCTGGCCCAGG - Intronic
947588421 2:231370926-231370948 CTACCTTCCTGGCCAGGCCCTGG + Intronic
947720621 2:232367477-232367499 GGAAATTCAAAGCCAGGCACAGG - Intergenic
947734149 2:232446189-232446211 GGAAATTCAAAGCCAGGCACAGG - Intergenic
947865173 2:233392318-233392340 CTAAATTAATGCCCAGGGCCAGG - Intronic
1173220048 20:41125184-41125206 GTAAATTAATGGAAGGGCCCTGG + Intergenic
1176171271 20:63697431-63697453 GCACATTGAGGGCCAGGCCCAGG - Exonic
1176857877 21:13985925-13985947 GTCACTTCAGGGCCAGGGCCAGG - Intergenic
1176866714 21:14058270-14058292 GTCACTTCAGGGCCAGGGCCAGG + Intergenic
1183484414 22:38081656-38081678 GGAAGTTGAGGGCCAGGCCCAGG + Exonic
1183581727 22:38730468-38730490 GTAAATTCCTGGTCAGGCTAGGG + Intronic
1184459891 22:44631115-44631137 GTCACCTCATGGCCAGCCCCTGG + Intergenic
1184665654 22:45987598-45987620 GCAAAGTCAGGGCCAAGCCCTGG + Intergenic
1185380869 22:50507045-50507067 GGCATGTCATGGCCAGGCCCTGG + Intronic
952557856 3:34553716-34553738 GTGAATTCATGGCTGAGCCCAGG + Intergenic
952702761 3:36343536-36343558 GGAAATTGATGGCCACTCCCTGG - Intergenic
953572615 3:44083161-44083183 GTAATTACAAGGCCAGGCACAGG + Intergenic
958883623 3:99701123-99701145 CTAAAATCATAGCAAGGCCCCGG + Intronic
965145070 3:164890421-164890443 GCAAATTCCTGGGCAAGCCCTGG - Intergenic
965948782 3:174278307-174278329 GTGAATTCAGGGCCAACCCCAGG + Intronic
966522183 3:180885775-180885797 GTAAATTCACTGCCATGTCCTGG - Intronic
967889554 3:194355378-194355400 GTAAATGCATCGCCAAGCACTGG + Intronic
968639635 4:1706516-1706538 GGAAATTTATGGCCAGGCAGTGG + Intronic
979038348 4:115754374-115754396 GTGGTTTCATGGCCAGGCCCAGG + Intergenic
984837767 4:184038500-184038522 GTAAATTCATTGTCAGGTCGAGG + Intergenic
985680428 5:1253052-1253074 GTAAATGCACAGCCAGGCCATGG + Intergenic
987140593 5:14941895-14941917 GTAAATTCCTGGTCTGGGCCGGG + Intergenic
995669950 5:114591654-114591676 GTAGATTCATGCCCTGGCCCTGG + Intergenic
997163582 5:131635021-131635043 GTGAGTTCATGGCCACGGCCCGG + Exonic
997285092 5:132672350-132672372 ATAAATTCATAGGGAGGCCCAGG + Intergenic
997441898 5:133914433-133914455 GGAAATGCTTGGCCAGGGCCTGG + Intergenic
998457298 5:142283130-142283152 GCAAATTCAGGGCTAGGACCAGG + Intergenic
999253872 5:150198786-150198808 ACACAGTCATGGCCAGGCCCTGG + Intronic
999953244 5:156672486-156672508 GTAAATTCATGGCCAGGCCCAGG - Intronic
1002187188 5:177459825-177459847 GGACATCCAGGGCCAGGCCCTGG - Intronic
1006359545 6:33579671-33579693 ATACATGCCTGGCCAGGCCCTGG + Intronic
1006625258 6:35393080-35393102 CCAAATTCAGGGCCAGGACCAGG + Intronic
1006727150 6:36207681-36207703 GAAAATACAGGGACAGGCCCAGG - Intronic
1009610230 6:65931351-65931373 GCAAAGTCAGGGCCAAGCCCAGG - Intergenic
1010672849 6:78707413-78707435 GTATATTCCTGGGCAGGCACAGG + Intergenic
1014632201 6:123802264-123802286 GAAAATTCAGTGCCAGGCTCTGG + Intergenic
1015302451 6:131669381-131669403 GTAAATTTTTAGCCAGGCACAGG + Intronic
1020802879 7:12754234-12754256 CTATACTCATGCCCAGGCCCAGG - Intergenic
1022010576 7:26304922-26304944 GTAAATCCAAAGCCCGGCCCAGG + Intronic
1022550943 7:31238138-31238160 ACAAACTCATGTCCAGGCCCTGG + Intergenic
1024570920 7:50722243-50722265 GTAAGTTTATGGCCAGTCCTTGG - Intronic
1025147143 7:56514680-56514702 GTAAGTTCAAGGCATGGCCCTGG + Intergenic
1028053160 7:86209057-86209079 GTAAAGTTGTGGCCAAGCCCAGG - Intergenic
1028690118 7:93641664-93641686 GTAAATTCCTGGCCAGGTGGGGG - Intronic
1029448799 7:100629230-100629252 GTAAGGTCAGGGCCAGGGCCTGG - Intronic
1030361249 7:108597369-108597391 TTAAATTCACTCCCAGGCCCTGG - Intergenic
1033980424 7:147157436-147157458 GTACATTTATGGGCAGGCACTGG - Intronic
1035131839 7:156661609-156661631 ATAAAATCCTGGCCAGGCCATGG - Intronic
1037041159 8:14235970-14235992 GTAAATTAAGGGTCAGGCACGGG - Intronic
1039482108 8:37881865-37881887 GACAATTCCAGGCCAGGCCCTGG - Intronic
1043334686 8:79160439-79160461 GTAGTTTCATGGCCTGCCCCAGG - Intergenic
1048602298 8:135931180-135931202 GTTCATTCCTGGCCAAGCCCAGG + Intergenic
1048983471 8:139715868-139715890 AAAGATTCAAGGCCAGGCCCTGG + Intergenic
1053067994 9:35081969-35081991 TTAAAAACATGGCCAGGGCCGGG + Intergenic
1053487944 9:38474574-38474596 GAAAATTGAGTGCCAGGCCCAGG - Intergenic
1057425346 9:94944700-94944722 GTAGATTAATGGTCAGGGCCTGG + Intronic
1061801735 9:133116562-133116584 GTGAACACAGGGCCAGGCCCGGG + Intronic
1062459040 9:136655238-136655260 GCAGAGTCATGGCCAGGGCCTGG + Intergenic
1062694013 9:137863177-137863199 GTAAAAGCTTGGCCAGGCGCGGG - Intronic
1186564168 X:10644619-10644641 GGAACTTCATGGCCAGACCGAGG - Intronic
1188162317 X:26819292-26819314 ATGGTTTCATGGCCAGGCCCAGG + Intergenic
1191229919 X:58085726-58085748 AGAGATTCCTGGCCAGGCCCAGG + Intergenic
1191980197 X:66916937-66916959 TTAACTTCATGGGCAGGCTCAGG - Intergenic
1193082268 X:77417554-77417576 GTAAATCCAGGGCCAAGCCAGGG - Intergenic
1194826938 X:98576131-98576153 TTAAATTCTTGGCAAGGCCTGGG - Intergenic
1194981241 X:100442975-100442997 GCAAATTCATAGCCAGGAGCTGG + Intergenic
1195403353 X:104485765-104485787 GGAAAGTCAGGGCCAGGGCCAGG - Intergenic
1199189350 X:144951988-144952010 ATAATTTCAGGGCCAGGCCTAGG - Intergenic