ID: 999955699

View in Genome Browser
Species Human (GRCh38)
Location 5:156699186-156699208
Sequence ATGGCTGTCTAGACACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 2, 2: 23, 3: 58, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999955699 Original CRISPR ATGGCTGTCTAGACACAGAC AGG Intronic
900007158 1:67779-67801 ATGACTGTCTAGACACAAGGAGG - Intergenic
904263763 1:29306099-29306121 AAGGCTTTAGAGACACAGACAGG - Intronic
904529352 1:31157832-31157854 TTGGCTTTATAGACACAGAAGGG - Intergenic
904958083 1:34305729-34305751 ATGGCTGGCTAGACACAGCCAGG + Intergenic
909899050 1:81109800-81109822 ATGGCTGACTAGAGGCAGCCAGG - Intergenic
910333892 1:86106029-86106051 ATGACTGACTAGACACAGCCAGG - Intronic
911979508 1:104549196-104549218 ATGGCTGACTAGACATGGCCAGG + Intergenic
913349446 1:117841971-117841993 ATGGCCAACTAGACACAGACAGG + Intergenic
914407213 1:147388620-147388642 ATGGCTGACTAGACACAGCCAGG + Intergenic
915759333 1:158295146-158295168 ATGGCTGACTAGATGCAGCCAGG + Intergenic
916738337 1:167627999-167628021 ATGGCTGCCTAAACACAGCTCGG + Intergenic
917567562 1:176229154-176229176 AAGGCTGACTAGACACAGCCAGG + Intergenic
921104046 1:211958836-211958858 ATGGCTGACTAGACACAGCCAGG + Intronic
923442275 1:234031863-234031885 AACACTGTCTAGACACAGCCTGG + Intronic
924331535 1:242945581-242945603 ATGGCCAACTAGACACAGCCAGG + Intergenic
924885304 1:248209566-248209588 GTGGCTGTCTAGCCACACAGTGG + Intergenic
1066162185 10:32746062-32746084 ATGGCTGACCAGACACAGCCAGG + Intronic
1067266730 10:44752668-44752690 ATGCCTATGTAGACACAGAAGGG + Intergenic
1068314054 10:55319453-55319475 ATGGCTGACTAGACATAGCCAGG + Intronic
1068463084 10:57351872-57351894 ATGGCTGACTAGATGCAGCCAGG - Intergenic
1069336535 10:67358345-67358367 ATGGCCAACTAGACACAGCCAGG + Intronic
1069806134 10:71126151-71126173 ATGGCTGACTAGACGCAGCCAGG - Intergenic
1071736087 10:88302882-88302904 ATGGCTGACTAGATGCAGCCAGG + Intronic
1072054555 10:91741172-91741194 ATGGTTGACTAGACACAGCCAGG - Intergenic
1073816713 10:107214951-107214973 ATGGCTGACTAGATGCAGCCAGG - Intergenic
1074634387 10:115296551-115296573 TTGGCTGTATAGACAGAAACTGG - Intronic
1075275379 10:121088370-121088392 AACACTGTCAAGACACAGACTGG - Intergenic
1075828853 10:125385526-125385548 ATGGCTGACTAGACACAGCCAGG - Intergenic
1076402833 10:130194791-130194813 GGGGCTGGCTAGACACAGGCAGG + Intergenic
1077035500 11:492541-492563 ATGGCTGATTGGACACAGCCTGG + Intergenic
1077504848 11:2925197-2925219 ACCGCTGCCCAGACACAGACTGG + Exonic
1077841780 11:5983057-5983079 ATGGCTGACTAGACACAGCCAGG - Intergenic
1078531869 11:12142871-12142893 ATGGCTCTCTGCACACAGAAGGG + Intronic
1078762523 11:14262693-14262715 ATGGCTGGCAAGACACAGATGGG - Exonic
1080224868 11:29949534-29949556 ATGGCTGACTAGATGCAGCCAGG + Intergenic
1081036235 11:38149484-38149506 AAGACTGACTAGACACAGCCAGG - Intergenic
1081077226 11:38692759-38692781 ATGGCTGACTAGAAGCAGCCAGG + Intergenic
1081292857 11:41348556-41348578 ATGGCCGACTAGATACAGCCAGG + Intronic
1081771612 11:45653582-45653604 ATGGCTTTCAAGAAACAGACAGG + Intronic
1081937385 11:46914610-46914632 ATGGCAGTCCAGACACAGTCTGG + Intronic
1082193541 11:49274571-49274593 ATGGCTAGCTAGACACAGCAAGG - Intergenic
1083459190 11:62799563-62799585 ATGGCTGGTTAGCCAGAGACGGG - Intronic
1084925974 11:72511497-72511519 ATGGCTGACTAAACACAGCCAGG - Intergenic
1085860787 11:80232924-80232946 ATAGCTGACCAGACACAGCCAGG + Intergenic
1086663869 11:89456414-89456436 ATGGCCGACTAGATACAGCCAGG + Intronic
1088806677 11:113359025-113359047 ATGGCTAACTAGATACAGCCAGG - Intronic
1088919318 11:114249959-114249981 ATGGGTGTCTAGAAAGAGAAAGG - Intronic
1089949574 11:122512732-122512754 ATCTCTTTCTAGACACAGCCAGG + Intergenic
1090162661 11:124511208-124511230 ACGGCTGACTAGACGCAGCCAGG - Intergenic
1092881459 12:12890889-12890911 GTGCCTGTCTAGACTCTGACAGG + Exonic
1093060651 12:14599287-14599309 ATGGCTGACTAGACATAGCCAGG - Intergenic
1093490560 12:19700218-19700240 ATGGCTGACTAAACACAGCCAGG + Intronic
1093542129 12:20299484-20299506 ATGGCTGACTAGAAGCAGCCAGG - Intergenic
1095259600 12:40083037-40083059 ATGGCTGACTAGATGCAGACAGG - Intronic
1096198285 12:49663212-49663234 ATAGCAGTATAGACTCAGACAGG - Intronic
1096473815 12:51895995-51896017 TTGGCTGTCCCGACACACACTGG + Intergenic
1097643225 12:62206144-62206166 ATGGCTGACTAGAAACAGCTGGG - Intronic
1098659420 12:73073451-73073473 ATGGCTGACTAGACACAGCCAGG - Intergenic
1101275760 12:103198915-103198937 ATGGCTGACTAGAAGCAGCCAGG - Intergenic
1102504798 12:113377115-113377137 ATGTCTCTCTAGGGACAGACTGG - Intronic
1102751338 12:115297282-115297304 ATGGCTCCAGAGACACAGACAGG - Intergenic
1103560272 12:121789926-121789948 TGGGCTGTGAAGACACAGACGGG - Intronic
1105396913 13:20044537-20044559 ATGGCTGACTAGACGCAGCCAGG - Intronic
1106925839 13:34612255-34612277 CTGGGTTTCTTGACACAGACTGG + Intergenic
1107033499 13:35877499-35877521 AAGGCTGTCTAGACACTCAAGGG - Intronic
1108317957 13:49256402-49256424 ATGGCTGCCTGGACACAGGGTGG - Intronic
1109650047 13:65313150-65313172 ATGGCTGACTAGAAACAGCTGGG + Intergenic
1111693481 13:91593364-91593386 ATGGCTGACTAGACATACCCAGG - Intronic
1113201806 13:107874885-107874907 ATGGCTGACTAGATGCAGCCAGG + Intergenic
1115017493 14:28634305-28634327 ATGGCTGACTAGACATAGCCAGG - Intergenic
1115894180 14:38065671-38065693 ATGGCTGTCCATAGACAGAGCGG - Intergenic
1115939155 14:38589500-38589522 ATGGCTGACTAGTCCCAGCCAGG - Intergenic
1116090401 14:40296644-40296666 ATGGCTGACTAGATGCAGCCTGG - Intergenic
1116162516 14:41288200-41288222 ATGGCTGACTAGAGGCAGCCAGG + Intergenic
1116984504 14:51204587-51204609 ATGGCTGACTAGATGCAGCCAGG - Intergenic
1118354066 14:64997294-64997316 CTGGCTGACTCCACACAGACAGG + Intronic
1118523190 14:66610519-66610541 ATGGCTGACTAGACACAGCCAGG - Intronic
1119127792 14:72144106-72144128 ATGGCTCTCCAGACACATAATGG - Intronic
1120700418 14:87692851-87692873 CTGCCTGTCCAGACTCAGACTGG + Intergenic
1123126904 14:105953435-105953457 ATGGCTGACTAGATGCAGCCAGG + Intergenic
1123158298 14:106251971-106251993 ATGGCTGGCACGAGACAGACAGG - Intergenic
1123407370 15:20029274-20029296 ATGGCTGACTAGATGCAGCCAGG + Intergenic
1123456200 15:20428133-20428155 ATGGCCGACTAGACACAGCCAGG - Intergenic
1123516697 15:21035930-21035952 ATGGCTGACTAGATGCAGCCAGG + Intergenic
1123635367 15:22302704-22302726 ATGGCCGACTAGACACAGCCAGG + Intergenic
1124649608 15:31465141-31465163 AGGGCTGTCGTGACACAGCCTGG - Intergenic
1126295014 15:47129976-47129998 ATGACTGTCTAGATACATTCTGG - Intergenic
1126490060 15:49226497-49226519 GTGGCTGACTAGACACAGCCAGG - Intronic
1126506323 15:49407499-49407521 ATGGCAGACTAGACAAAGCCAGG - Intronic
1126883236 15:53122037-53122059 TTGCCTGTCTAGACACAGTCAGG + Intergenic
1128968831 15:72087721-72087743 ATGGCTGACTAGACACAGCCAGG - Intronic
1129572298 15:76700641-76700663 ATGGCTGACTAGATGCAGCCAGG - Intronic
1130031890 15:80322978-80323000 GTGGCTGTCTGGAGACAGAGTGG - Intergenic
1131711781 15:95063154-95063176 ATTGCTGACTAGACTCAGCCAGG - Intergenic
1131945594 15:97616855-97616877 ATGGCTGTGATGACAAAGACGGG + Intergenic
1132446364 15:101923914-101923936 ATGACTGTCTAGACACAAGGAGG + Intergenic
1132868033 16:2103484-2103506 ATGGCATTCCAGACACAGGCCGG - Exonic
1134523740 16:14929640-14929662 ATGGCGTTCCAGACACAGGCCGG + Intronic
1134549161 16:15131296-15131318 ATGGCGTTCCAGACACAGGCCGG - Intronic
1134711331 16:16328125-16328147 ATGGCGTTCCAGACACAGGCCGG + Intergenic
1134719182 16:16371427-16371449 ATGGCGTTCCAGACACAGGCCGG + Intergenic
1134948245 16:18340458-18340480 ATGGCGTTCCAGACACAGGCCGG - Intergenic
1134955498 16:18380568-18380590 ATGGCGTTCCAGACACAGGCCGG - Intergenic
1136651316 16:31673920-31673942 ATGGCCAGCTAGACACAGCCAGG - Intergenic
1137323464 16:47410447-47410469 ACGGCTGACTAGACACAGCCAGG + Intronic
1139308863 16:66011487-66011509 ATGGCTGACTAGATGCAGCCAGG + Intergenic
1141070914 16:80954122-80954144 ATGGCTGACTAGACACAGTCAGG + Intergenic
1141111285 16:81272946-81272968 ATGGGGGTTTAGAGACAGACTGG - Intronic
1141506673 16:84482650-84482672 ATGGCTGTGTACACACACACGGG - Exonic
1142311893 16:89319023-89319045 ATGGCTGTCTAGAAACTCAGTGG + Intronic
1143127656 17:4654546-4654568 ATGCCTGTGAAGAGACAGACGGG + Intergenic
1143428818 17:6863493-6863515 ATGGCTGACTAGATGCAGCCAGG - Intergenic
1148189061 17:45666312-45666334 GTGGCAGTCTGGACACAGGCAGG - Intergenic
1149078655 17:52628915-52628937 ATGGCTGACTAGATGCAGCCAGG + Intergenic
1150018847 17:61589861-61589883 ATGGCAGTAGAGACACAGAGAGG + Intergenic
1150971207 17:70030088-70030110 ATGGCTGACTAGACACAGCTAGG - Intergenic
1151466739 17:74290477-74290499 AGGGCTGGCAAGACACAGGCAGG + Intronic
1153085174 18:1278145-1278167 ATGGCTGACTAGATGCAGCCAGG + Intergenic
1153410575 18:4788746-4788768 ATGGCTGACTAGACACAGCCAGG + Intergenic
1154332998 18:13444974-13444996 ATGGCAGTCTAAACACACATGGG - Intronic
1156954820 18:42949484-42949506 TTGCCTGTCTAACCACAGACTGG - Intronic
1158244901 18:55421200-55421222 ATGCCTGTGTACACACACACAGG + Intronic
1160638912 19:109367-109389 ATGACTGTCTAGACACAAGGAGG - Intronic
1161529130 19:4776633-4776655 AAGGATGCCAAGACACAGACAGG + Intergenic
1162095227 19:8306262-8306284 ATGCCTGTCCACCCACAGACTGG + Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1165753864 19:38280092-38280114 GCAGCTGTCTAGACACAGAATGG + Intronic
1166300762 19:41910975-41910997 ATGCCTGACAAGACACACACAGG + Intronic
926103182 2:10133628-10133650 GTGTCTGTCTGGACACAGAAGGG + Intergenic
926279771 2:11436448-11436470 ATTGCTGTAGGGACACAGACGGG - Intergenic
926479670 2:13377032-13377054 ATGGCCGACTAGACACAGCCAGG + Intergenic
927007092 2:18861893-18861915 ATGGCTGACTAGCCACAGCCAGG - Intergenic
930570877 2:53085369-53085391 ATGGCTGGCTATTCATAGACTGG + Intergenic
931016224 2:57983207-57983229 ATGGCTGACTAGATACAGCCAGG - Intronic
931549153 2:63423857-63423879 ATGGCCAACTAGACACAGCCAGG + Intronic
931654722 2:64500589-64500611 ATGGTTCTCTAGAGACAGGCAGG + Intergenic
932541902 2:72664184-72664206 ATGGCTGACTAGACACAGCAAGG + Intronic
933272963 2:80253180-80253202 CTGGCTGGGTAGACACAGAAAGG - Intronic
934219197 2:90065732-90065754 ATGGCTGACTAGTCACAGCCAGG - Intergenic
935634902 2:105242722-105242744 AGCGCTGGCTAAACACAGACAGG - Exonic
936501172 2:113067543-113067565 CTGGCTGTCTGGCCACAGCCTGG + Intergenic
936909199 2:117572788-117572810 ATGACCAACTAGACACAGACAGG - Intergenic
939199816 2:139019124-139019146 ATGGCTGACTAGACACAGCCAGG - Intergenic
939441987 2:142261313-142261335 ATGGCCAACTAGACACAGCCAGG - Intergenic
939953289 2:148501717-148501739 ATAGCTGACCACACACAGACTGG + Intronic
940464876 2:154014538-154014560 ATGGCTGACCTGACACAGCCAGG - Intronic
940535463 2:154935519-154935541 ATGGCCAACTAGACACAGCCAGG - Intergenic
941054845 2:160776330-160776352 ATGGCTGACTAGATGCAGCCAGG + Intergenic
941681275 2:168401917-168401939 GTGGCCATCTAGACACAGCCAGG - Intergenic
941866778 2:170343589-170343611 ATGGGTGTCTGGACACTGAGAGG + Intronic
943093930 2:183405583-183405605 ATGGCCAACTAGACACAGCCAGG - Intergenic
944621654 2:201522356-201522378 ATGGCCAACTAGACACAGCCAGG + Intronic
945132047 2:206584126-206584148 CTGGATGGCTAGACACAGAAGGG - Intronic
945263470 2:207866785-207866807 ATGGCTTTCTAGATCAAGACAGG - Intronic
1172313251 20:33934008-33934030 AGGGATGTCCAGACGCAGACGGG - Intergenic
1173292700 20:41728415-41728437 ATGGCCAACTAGACACAGCCAGG - Intergenic
1174771436 20:53304416-53304438 ATGGCAGCCTAGACCAAGACTGG - Intronic
1175823395 20:61923934-61923956 AGCACTGTCTAGACACAGGCCGG + Intronic
1177044011 21:16146732-16146754 ATGGCTGACTAGACGCAGCCAGG - Intergenic
1182583281 22:31328051-31328073 ATGGCTCTCTGGACCCAGGCAGG - Intronic
1183164031 22:36133972-36133994 CTGGCTGTCTAGAAACAGAGAGG - Intergenic
949145040 3:690337-690359 ATGGCCAACTAGACACAGCCAGG + Intergenic
949661339 3:6282958-6282980 ATGGCTGACTAGATGCAGCCAGG + Intergenic
955362597 3:58288463-58288485 AGGGCCATCTAGAGACAGACAGG + Intronic
958462525 3:94417957-94417979 ATGGCTGACTAGAGGCAGCCAGG + Intergenic
960755032 3:121001857-121001879 ATGGCTGACTAGACACAGCTAGG - Intronic
960785946 3:121372762-121372784 ATGGCTGACTAGATGCAGCCAGG - Intronic
962335748 3:134528309-134528331 ATGGCTGACTAGACACAGCCAGG - Intronic
962465037 3:135649854-135649876 ATGGTTGACTAGACACAGCCAGG - Intergenic
962655862 3:137543249-137543271 ATGGTTGAGTAGACACAGTCAGG - Intergenic
966080185 3:175990468-175990490 ATGGCTGACTAGACACAGCCAGG - Intergenic
967034426 3:185637515-185637537 ATGGCTGAGTAGACAGAGAAGGG - Intergenic
967194983 3:187018293-187018315 CTGGTTGGCTAGACACAGAAGGG - Intronic
967523585 3:190466178-190466200 ATGGCCAATTAGACACAGACTGG + Intergenic
969394699 4:6912601-6912623 GTGGCCTTGTAGACACAGACTGG + Intronic
969724788 4:8912630-8912652 GTGGCTCTCTGGACACAGCCAGG - Intergenic
971729746 4:30361763-30361785 ATGGCTGATTAAACACAGCCAGG - Intergenic
972995248 4:44870885-44870907 ATGGCTGTCTAGACACAGCCAGG - Intergenic
974621352 4:64360533-64360555 ATGGCTGACTAGACGGAGTCAGG + Intronic
974650632 4:64749186-64749208 ATGGCTGACTAGATGCAGACAGG - Intergenic
976375334 4:84339359-84339381 ACGGCTGACTAGACACAGCCAGG - Intergenic
978054807 4:104249863-104249885 ATGGCTGACTAGACACAACTAGG - Intergenic
980469500 4:133233562-133233584 ATGGCTGACTAGACACGGCCGGG + Intergenic
980862943 4:138521478-138521500 ATACCTGACTAGACACAGCCAGG + Intergenic
981511734 4:145565737-145565759 ATGGCTGACTAGACACAGCCAGG + Intergenic
983020851 4:162674492-162674514 ATGGTTGACTAGACACAGTCAGG + Intergenic
985416800 4:189743081-189743103 CTGGGTGTCTAGACCCAGAAGGG + Intergenic
986479129 5:8166694-8166716 ATGACTGACTAGACAAAGCCAGG - Intergenic
987223993 5:15820726-15820748 ATGCCTGGCTCCACACAGACCGG + Intronic
987582837 5:19819333-19819355 ATGGCCAACTAGACACAGCCAGG + Intronic
988200730 5:28065985-28066007 ATGGCCAACTAGACACAGCCAGG + Intergenic
988306456 5:29499652-29499674 ATGGCTGACTAGACATAACCAGG - Intergenic
988853070 5:35197959-35197981 ATGGCTGTCCTGACAAAGGCAGG + Intronic
988870431 5:35384277-35384299 ATGGCTGACTAGACATAGCCAGG + Intergenic
989323522 5:40164754-40164776 ATGGCCAACTAGACACAGCCAGG + Intergenic
991577590 5:68121674-68121696 GTGGCTGTCTAGATAGAGCCAGG + Intergenic
993115534 5:83715733-83715755 TTGGCTGTGTGGACACAGATGGG - Intronic
993178591 5:84519387-84519409 ATGGCTGACTAGACACAGCCAGG - Intergenic
994597550 5:101859634-101859656 ATGGCCGACTAGACCCAGCCAGG + Intergenic
996888672 5:128389967-128389989 ATGGCTCAGTAGACACAGCCAGG - Intronic
996954384 5:129164970-129164992 ATGGCCCACTAGACACAGCCAGG - Intergenic
997021408 5:130007312-130007334 ATGGCTAACTAGACACAGACAGG + Intronic
997095944 5:130911647-130911669 ATGGCAGTGTAGAAACAAACTGG + Intergenic
997187813 5:131900196-131900218 TTGGCTGACTAGACACAGCCAGG + Intronic
998077886 5:139251102-139251124 ATCGCTCTCTAGAAACAGAGGGG + Intronic
998647174 5:144075565-144075587 ATGGCTGAATAGACACAGTCAGG + Intergenic
998944978 5:147329150-147329172 ATGGCTGTGTAGAAAAACACAGG + Intronic
999955699 5:156699186-156699208 ATGGCTGTCTAGACACAGACAGG + Intronic
1003653038 6:7978820-7978842 CTGCCTGTCTAGCCTCAGACTGG - Intronic
1006436810 6:34029972-34029994 ATGCCGCTCCAGACACAGACAGG + Intronic
1007461656 6:42023675-42023697 ATGGATGAGTAGATACAGACTGG - Intronic
1008642949 6:53483429-53483451 ATGGCTGTTTAGACAGGGACAGG - Intergenic
1009208340 6:60832251-60832273 ATGGCTGACTAGATGCAGCCAGG + Intergenic
1010809876 6:80289418-80289440 ATGGCTGACTAGATGCAGCCAGG + Intronic
1011290667 6:85773269-85773291 ATGGCTGACTAGATGCAGCCAGG - Intergenic
1011337467 6:86276727-86276749 ATGACTGACTAGACATAGCCAGG - Intergenic
1013393915 6:109714408-109714430 ATGGCTGACTAGAGGCAGCCAGG - Intronic
1016075471 6:139789621-139789643 ATGGCCATCAAGACACAGCCAGG - Intergenic
1016237437 6:141886148-141886170 ATGGCTGACTAGAAGCAGCCAGG + Intergenic
1016544569 6:145206511-145206533 ATGGCTCTCTGAACACAAACTGG - Intergenic
1016910778 6:149196526-149196548 ATAGCTGTGGAAACACAGACAGG + Intergenic
1017001516 6:150000501-150000523 ATGGATATACAGACACAGACAGG + Intergenic
1020381832 7:7556363-7556385 ATGGCTGACTGGACACAGCCAGG + Intergenic
1023256459 7:38317660-38317682 AGGACTGTCTTCACACAGACTGG - Intergenic
1023439668 7:40172713-40172735 AGGGCTGACTAGAGACAGAAAGG - Intronic
1023570865 7:41570221-41570243 ATAGCCGTCTAGACAAAGGCAGG + Intergenic
1024783833 7:52883291-52883313 ATGTGTGTGTACACACAGACAGG + Intergenic
1025861966 7:65338741-65338763 ATGACTGACTAGACACAGCCAGG + Intergenic
1026659560 7:72288115-72288137 ATTGCGGTCAAGACACTGACTGG + Intronic
1027733665 7:81906397-81906419 ATGGCCGTCTAGATGCAGCCAGG + Intergenic
1031256157 7:119451053-119451075 ATGGCTGACTAGACACAGCCAGG - Intergenic
1031549927 7:123097114-123097136 GTGGCTAACTAGACACAGCCAGG + Intergenic
1032310407 7:130780751-130780773 ATGGCTGACTAGACACAGCCAGG - Intergenic
1036422490 8:8611444-8611466 ATGGTTTTCTAAACTCAGACTGG - Intergenic
1038860001 8:31376287-31376309 ATGGCCAACTAGACACAGCCAGG - Intergenic
1038876554 8:31557680-31557702 ATGGCTGACTAGATGCAGCCAGG + Intergenic
1039264290 8:35808347-35808369 ATGTCTGACTAGACACAGCCTGG + Intergenic
1040482639 8:47840878-47840900 ATGGCTGAATAGACATAGCCAGG + Intronic
1043545198 8:81307104-81307126 CTGGGTGGCTAGACACAGAAAGG + Intergenic
1043698521 8:83252164-83252186 CTGGCTGACTAGGCACAGCCAGG - Intergenic
1043967442 8:86495049-86495071 ATGGCTGACTAGGCACAGCCAGG + Intronic
1044224230 8:89701294-89701316 ATGGCTGACTAGACCCAGCCAGG - Intergenic
1044818467 8:96137576-96137598 AAGACTATCTTGACACAGACAGG + Intergenic
1046170194 8:110496049-110496071 ATGGATGTGTAGAAACAGCCTGG - Intergenic
1047168401 8:122466155-122466177 GTGGCTGACTAGACACAGCCAGG + Intergenic
1048037892 8:130694271-130694293 ATGGCTGACTAGACACAGCCGGG - Intergenic
1050475219 9:6034163-6034185 ATAGCTGACTAGACACAGCCAGG + Intergenic
1053444860 9:38144836-38144858 ATGGCTGTCTGGATAAAGAAGGG - Intergenic
1053530669 9:38878429-38878451 ATGGCTGACTAGACGCAGCCAGG + Intergenic
1053543098 9:38994461-38994483 ATGGCTGACTAGACACAGCCAGG - Intergenic
1053605979 9:39658868-39658890 ATGGCCAACTAGACACAGCCAGG - Intergenic
1053807534 9:41817978-41818000 ATGGCTGACTAGACACAGCCAGG - Intergenic
1053863899 9:42415492-42415514 ATGGCCAACTAGACACAGCCAGG - Intergenic
1054202893 9:62102862-62102884 ATGGCTGACTAGACGCAGCCAGG + Intergenic
1054247565 9:62683548-62683570 ATGGCCAACTAGACACAGCCAGG + Intergenic
1054561681 9:66718075-66718097 ATGGCCAACTAGACACAGCCAGG + Intergenic
1054623058 9:67369449-67369471 ATGGCTGACTAGACACAGCCAGG + Intergenic
1054635470 9:67485503-67485525 ATGGCTGACTAGACGCAGCCAGG - Intergenic
1055566639 9:77575884-77575906 ATGGCTGTGTTGACACAAAATGG - Intronic
1055783308 9:79843373-79843395 ATGGCTGACTACAAACAGCCAGG - Intergenic
1055990817 9:82103161-82103183 ATAGCTGACTAGACACAGCCAGG - Intergenic
1058572284 9:106359324-106359346 ATGGCTGACTAGACAAAACCAGG - Intergenic
1058727254 9:107816018-107816040 ATGGCTGGGATGACACAGACTGG + Intergenic
1059075677 9:111191454-111191476 GTAGCTGTAAAGACACAGACTGG + Intergenic
1061598206 9:131646497-131646519 ATGGCTGTGGAGCCACAGCCTGG - Intronic
1203636334 Un_KI270750v1:116565-116587 CTGGGTGTCTAGACCCAGAAGGG - Intergenic
1185663865 X:1748862-1748884 AGGGAGGTCTAGACACAGAGTGG + Intergenic
1185754097 X:2638961-2638983 CTGGCTGTCCAAACTCAGACTGG - Intergenic
1187601859 X:20839962-20839984 ATGGCTGACTAGACACATCCAGG - Intergenic
1188492937 X:30755488-30755510 ATGGCTGGCTAAACACAGCCAGG + Intergenic
1188719095 X:33500699-33500721 ATGGGTGGCTAGACCCAGAAGGG + Intergenic
1188885572 X:35545976-35545998 ATAGCTGACTAGACACAATCAGG + Intergenic
1188943487 X:36267032-36267054 ATGGCTAACTAGACACAGCCAGG - Intronic
1189558290 X:42166959-42166981 ATGGCTGACTAGATGCAGCCAGG - Intergenic
1190604420 X:52126299-52126321 ACGGTTGACTAGACACAGCCAGG + Intergenic
1190808674 X:53863372-53863394 ATGGCCAACTAGACACAGCCAGG + Intergenic
1191609889 X:63101428-63101450 ATGGCTGACTAGGCGCAGCCTGG + Intergenic
1191919511 X:66239440-66239462 GTGGCTGACCAGACACAGCCAGG - Intronic
1191933947 X:66405611-66405633 ATGGCCTACTAGACACAGCCAGG - Intergenic
1192766493 X:74145867-74145889 ATGGCTGTCTAAATGCAGCCAGG + Intergenic
1193016119 X:76736506-76736528 ATGGCCAACTAGATACAGACAGG + Intergenic
1193036723 X:76958725-76958747 ATGGCTGACTAGATGCAGCCAGG - Intergenic
1193291532 X:79778282-79778304 ATGGCTGACTAGACACAGACAGG - Intergenic
1193611093 X:83631951-83631973 ATGGCTGACTAGACTCAGCAAGG - Intergenic
1193689495 X:84622996-84623018 ATGGCAAACTAGACACAGCCAGG - Intergenic
1193790384 X:85809045-85809067 ATGGCTGACTACATACAGCCAGG - Intergenic
1193927901 X:87512669-87512691 ATGGATATCAAGGCACAGACAGG + Intergenic
1194060795 X:89195295-89195317 CTGGCCAACTAGACACAGACAGG + Intergenic
1194217596 X:91149026-91149048 ATGGCAGACTACACACAGCCAGG - Intergenic
1194244919 X:91499619-91499641 ATGGCCAGCTAGACACAGCCAGG + Intergenic
1194346533 X:92772885-92772907 ATGGCTGAGTAGACTCAGCCAGG + Intergenic
1194549043 X:95273719-95273741 ATGGCCAACTAGACACAGCCGGG + Intergenic
1194872652 X:99152589-99152611 ATGACAGACTAGACATAGACAGG + Intergenic
1195173000 X:102286852-102286874 ATGGCTGACCAGATGCAGACAGG - Intergenic
1195185866 X:102400243-102400265 ATGGCTGACCAGATGCAGACAGG + Intronic
1195289239 X:103415091-103415113 ATGGCCGACTAGATACAGCCAGG - Intergenic
1195585985 X:106566165-106566187 ATGGCTGACTAGACACAGCAAGG + Intergenic
1196230573 X:113216565-113216587 ATGGCTGACTAGATGCAGCCAGG - Intergenic
1196519770 X:116660300-116660322 ATGGCTGACTACACGCAGCCAGG + Intergenic
1196554291 X:117069585-117069607 ATGGCTGACTAGACACAGCCAGG + Intergenic
1197034000 X:121853406-121853428 ATGGCTAACTAGACACATCCAGG + Intergenic
1197093792 X:122571112-122571134 ATGGCTGACTAGACACAGCTAGG + Intergenic
1197370749 X:125622472-125622494 ATAGCTGACTAGACACAGCTGGG - Intergenic
1197374245 X:125663182-125663204 ATGGCTTACTAGACACAGCCAGG + Intergenic
1197378739 X:125713202-125713224 ATGGATGACTAGACACAGCTAGG + Intergenic
1197482437 X:127004324-127004346 ATGGGTGACTAGACACAGCTAGG + Intergenic
1197570563 X:128146411-128146433 ATGGCTGACTACACCCAGCCAGG + Intergenic
1197599935 X:128517193-128517215 ACAGCTGACTAGACACAGTCAGG + Intergenic
1197790296 X:130248116-130248138 ATGGCAAACTAGATACAGACAGG + Intronic
1198885074 X:141326895-141326917 ATGGCTGACTAAGCACAGCCAGG + Intergenic
1199270233 X:145873732-145873754 ATGGCTAACTAGACACAGTCAGG - Intergenic
1199640615 X:149857920-149857942 ATGGTTAACTAGACACAGCCAGG + Intergenic
1199912931 X:152307554-152307576 ATGGCAGACTAGACATAGCCAGG + Intronic
1200554107 Y:4612822-4612844 ATGGCAGACTACACACAGCCAGG - Intergenic
1200563895 Y:4740929-4740951 ATGGCCAGCTAGACACAGCCAGG + Intergenic
1201228875 Y:11844745-11844767 ATGGCCAACTAGACACAGCCAGG + Intergenic