ID: 999957114

View in Genome Browser
Species Human (GRCh38)
Location 5:156714601-156714623
Sequence CCCTAGGAGCAGTGGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999957107_999957114 10 Left 999957107 5:156714568-156714590 CCAGAGGCTCACAGAAACCTAAG 0: 1
1: 6
2: 49
3: 149
4: 378
Right 999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 114
999957108_999957114 -7 Left 999957108 5:156714585-156714607 CCTAAGCCTATGTTTCCCCTAGG 0: 1
1: 1
2: 16
3: 86
4: 321
Right 999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999957114 Original CRISPR CCCTAGGAGCAGTGGCTCAA AGG Intronic
900573223 1:3370197-3370219 CCCTAGGTGCAGTGTCACAGTGG - Intronic
902831290 1:19014591-19014613 CCCTCTGAGCAGGGACTCAAAGG + Intergenic
905017268 1:34786271-34786293 CCCTGGGAGCAGGGTCTGAAAGG - Exonic
906461050 1:46035322-46035344 CCCTAGGAGCCTGGGCCCAATGG + Exonic
915068826 1:153248575-153248597 CCCTAGGATGAGGGGCTCCAAGG + Intergenic
916123660 1:161550605-161550627 GCCTAGGAGCCGGGGCTCCAGGG + Intronic
919150630 1:193693078-193693100 CCCAAGGATCAGTTTCTCAAAGG - Intergenic
919779757 1:201214179-201214201 CCCTGGGAGAAGTGGCCCATGGG - Exonic
920940895 1:210481203-210481225 CCCTAGAAGCAATGGCCCAGTGG - Intronic
920945300 1:210523232-210523254 CCCAAGTGGCAGTGGCACAAGGG - Intronic
923146351 1:231201391-231201413 TCTCAGGAGCAGTGGGTCAAAGG + Exonic
923365780 1:233259128-233259150 CCCTCGGATCTGTGGCGCAAAGG + Exonic
923666443 1:236002581-236002603 GCCTAGGCGCAGTGGCTGAACGG + Intronic
924594820 1:245435798-245435820 CCCAAGGAGCAGTGGCTAGCAGG - Intronic
1066636838 10:37511625-37511647 CTGTAGGAGCAGTGTCCCAATGG + Intergenic
1068754512 10:60636307-60636329 ACCAAGAAGCAGTGGTTCAAAGG + Intronic
1071974035 10:90937321-90937343 GCCCAGGAGCAGGAGCTCAAAGG - Intergenic
1073113096 10:101074291-101074313 GCCAAGGAGCTGTGGCTCAAAGG + Intergenic
1073276090 10:102312735-102312757 CACCAGGAGCAGTGTCTCATGGG - Intronic
1073318109 10:102597055-102597077 CTGTAAGAGCAGTGGCTGAAAGG + Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1077169717 11:1160756-1160778 CCCTAAGACCAGTGGCCCTAGGG - Intronic
1077405204 11:2379499-2379521 ACCTAGGGGCAGAGGCTGAAGGG + Intronic
1077896263 11:6455929-6455951 CCTTAAGAGCAGTGAATCAAAGG - Intronic
1078467635 11:11561934-11561956 ACCAAGTAGCAGTGGCTCACAGG + Intronic
1079391970 11:20029651-20029673 ACACAGGGGCAGTGGCTCAATGG + Intronic
1083290862 11:61689225-61689247 CCCTAGGCCCAGTGGCTAAGGGG + Intronic
1083592361 11:63903189-63903211 CCCTAGGAGCCATGTCTCACAGG + Intronic
1084065956 11:66704646-66704668 GAGAAGGAGCAGTGGCTCAACGG - Exonic
1084667018 11:70582009-70582031 CCCTAGGAGCTGCTGGTCAATGG + Intronic
1085011086 11:73142168-73142190 CCCCAGGAGCAGGGGCGCGAGGG + Exonic
1086936372 11:92749819-92749841 CCCTAGGAGCACAGTCTCTATGG - Intronic
1087532837 11:99406461-99406483 TCCTAGGAGCAGTGGCCACAGGG - Intronic
1089691658 11:120190643-120190665 CCCTAGGCCCAGGGGCTGAAGGG - Intergenic
1092140647 12:6180936-6180958 GCCTGGGAGCAGAGGCCCAAAGG + Intergenic
1102064381 12:109961414-109961436 TCCCAGGAGCAGTGGCACACAGG - Intronic
1112160292 13:96860018-96860040 CCCTAGGAGGAGTGGTTGGATGG - Intergenic
1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG + Intergenic
1118018487 14:61685997-61686019 GGCCAGGAGCAGTGGCTCAGTGG + Intergenic
1122160782 14:99782298-99782320 CCCTAGGACCAGAGGCTCAGGGG - Intronic
1125181192 15:36882431-36882453 CCCTAGGAGCGCTGGTTCTAGGG + Intergenic
1125406619 15:39358855-39358877 TCCTAGCAGCAGTGGCTCTATGG - Intergenic
1125578508 15:40770379-40770401 CCCTAGGAGCAGAGGCCTCAGGG - Exonic
1129030904 15:72616934-72616956 CCCTAGAAGCTGTGGCCCAGAGG + Intergenic
1129070444 15:72946239-72946261 CCCTAGCAGCAGGGGCCCCAAGG + Intergenic
1129180595 15:73872290-73872312 ACCTAGGGGCAGTAGATCAAAGG + Intergenic
1129708828 15:77809841-77809863 ACCTCGGACGAGTGGCTCAATGG - Intronic
1132700654 16:1220732-1220754 CCCGAGGTCCAGCGGCTCAAAGG - Exonic
1133579488 16:7129386-7129408 GCATAGGAACAGTAGCTCAAAGG + Intronic
1139911638 16:70400886-70400908 CCCCAGCAGCACTGGCTCAAAGG + Intronic
1141187280 16:81796971-81796993 CCATAGTATCAGTGGCTGAATGG - Intronic
1142502325 17:339998-340020 CCCTCAGAGCAGAGGCACAAAGG + Intronic
1144643219 17:16950812-16950834 CACTATGAGCAGAGGCTCAGAGG - Intronic
1149007924 17:51824732-51824754 GTCTAGGAGCAGTTGCCCAAAGG - Intronic
1152052973 17:77996834-77996856 TTCTAGGGGCAGTGGCTCCAGGG - Intergenic
1153004812 18:488576-488598 GGCTAGGTGCAGTGGCTCACTGG + Intronic
1153274105 18:3351191-3351213 CCAAAGGAGCAGTTGTTCAAAGG + Intergenic
1153449342 18:5209550-5209572 CCCTGGGAACATTGGCTCATTGG + Intergenic
1156078967 18:33312536-33312558 CCCTAGGAGTACTAACTCAAGGG + Intronic
1158820223 18:61150710-61150732 CCCTAGGAGCAGGTGCAGAAAGG + Intergenic
1159026575 18:63187958-63187980 CCCTATGAGCAGGGGCCAAATGG - Intronic
1162627256 19:11894614-11894636 CCCTGGGAGGAGTGACTCAGGGG - Intronic
1163630836 19:18417332-18417354 CCCAAGGAACCGTGGCTCACAGG + Intergenic
1165146410 19:33733837-33733859 CTCTAGGAGCACTTTCTCAACGG + Intronic
1166313950 19:41978284-41978306 CCCGAGGAGCAGTTCCCCAAGGG - Exonic
1167667993 19:50833778-50833800 CACCAGGAGCAGTTCCTCAAGGG + Intronic
1168141105 19:54387902-54387924 CCCTAGGTGCTGAGGCTCACGGG - Intergenic
929175118 2:38968171-38968193 AACTAGGAGCAGTGGCTAAGAGG + Intronic
929578811 2:43069084-43069106 CACTAGGGTCAGGGGCTCAAGGG + Intergenic
932121493 2:69104749-69104771 CCCTATGTGCCGTTGCTCAAAGG + Intronic
936357915 2:111767333-111767355 TCCTTAGAGCCGTGGCTCAAAGG - Intronic
942673175 2:178398818-178398840 CCCAAGGAGCAGTGGCTTGGGGG + Intronic
945922579 2:215770754-215770776 CACCAGCAGCAGTGGCTCATGGG - Intergenic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
1170788143 20:19485712-19485734 CCTTAGGAGCTGTGGATCAGAGG - Intronic
1178121359 21:29473485-29473507 TCCTGGGAGCAGTGGCTGAGAGG + Intronic
1178191679 21:30289336-30289358 CCATAGGAGAAATAGCTCAAGGG + Exonic
1178888921 21:36504857-36504879 CTCTGGGAGCAGTGACTCATGGG - Intronic
1181169146 22:20998504-20998526 CCCAAGGAGCTGTGGCTTCATGG - Exonic
1183323699 22:37180301-37180323 GCCGAGGAGCCGTGGCTCCATGG - Exonic
1183922572 22:41181181-41181203 CCCTAGTAGCTGGGACTCAAAGG + Intergenic
951243743 3:20316524-20316546 CCCCAGCTGGAGTGGCTCAAAGG - Intergenic
954675722 3:52314348-52314370 CTCCAGGAGCAGCGGCCCAAGGG - Intergenic
955819942 3:62886060-62886082 CCCTGGGAACAGAGGCTCAGGGG + Intergenic
958822231 3:98988697-98988719 CCCTAGGAGCCTTGGCTGAAGGG + Intergenic
960131899 3:114065693-114065715 CCCTGGGAGCAGTGGCGACATGG - Intronic
960156297 3:114299968-114299990 CTCTCAGAGCAGTGGCTTAAGGG - Intronic
961818962 3:129565576-129565598 CCCTAGGAGCTGTGGGTCCCAGG + Intronic
964546112 3:157835453-157835475 CACTAGGGCCAGTGGCTCATAGG - Intergenic
975136837 4:70883460-70883482 AACCAGGTGCAGTGGCTCAATGG + Intergenic
975668913 4:76760614-76760636 CCCTAGGAGCAGAGGGTAACTGG + Intronic
977125765 4:93165594-93165616 CCCTAAGAGCAGAGTCCCAAAGG + Intronic
986281451 5:6326208-6326230 CCAGAGGAGCAGTTGGTCAATGG - Intergenic
995447457 5:112261568-112261590 GCCTAAGAGAAGTAGCTCAAAGG + Intronic
995991237 5:118242047-118242069 CCCTATCAGCATTGGTTCAATGG + Intergenic
996072736 5:119152830-119152852 ACCAAGGAGCAGAGGCTAAAAGG - Intronic
996332184 5:122342319-122342341 CCCTGGGAGCAGTGACTCCATGG - Intronic
998797212 5:145833375-145833397 ACAAAGGAGCAGTGGCTTAAGGG + Intronic
999232332 5:150069145-150069167 CCCTGGTAGCAGTTGCTCCAAGG + Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1003879113 6:10464372-10464394 CCCTAGTTTCAGTGGCACAAAGG - Intergenic
1008440062 6:51522587-51522609 ACCTAGGGGAAGTGGCTCCAGGG - Intergenic
1015439189 6:133228125-133228147 ACATAGGAGCAGTGGCTTCAGGG + Intergenic
1016732460 6:147441412-147441434 CTCAAGGAGCAGTGGAACAAAGG - Intergenic
1018099532 6:160424163-160424185 CCCTAGGATCTGTGGCCCACTGG - Intronic
1021308796 7:19065654-19065676 CTGGAGCAGCAGTGGCTCAAAGG + Intronic
1021806450 7:24361690-24361712 TCCTATGAGCAGTGGAGCAATGG - Intergenic
1023622625 7:42088506-42088528 CCATAGGAGCAGGTGCTCTAAGG - Intronic
1029435449 7:100561750-100561772 CCCGAGAAGCAGCGGCTAAATGG + Intronic
1030961787 7:115932107-115932129 GCCTAGGAGAAGTGACACAAAGG + Intergenic
1037389188 8:18374781-18374803 CCCCAGGAGCAGTGCATAAAAGG - Intergenic
1038691180 8:29764959-29764981 CCCTAGGAGCCCTCTCTCAATGG + Intergenic
1057563820 9:96150612-96150634 CCCTAGAACCACTGGCTTAAAGG + Intergenic
1060656177 9:125374219-125374241 CCCTAGGAGCACAGGCTCCAGGG - Intergenic
1061879968 9:133563675-133563697 CCCAAGGTGCAGTGGGGCAAAGG + Intronic
1062208972 9:135353037-135353059 CCCTGGGATGAGTGCCTCAAAGG - Intergenic
1189230902 X:39451539-39451561 CCATAGCAGCAGTGACTTAAGGG - Intergenic
1190484901 X:50914300-50914322 GGCTGGGTGCAGTGGCTCAAAGG + Intronic
1193836009 X:86344788-86344810 CCCTAGGAGCAATGAGACAAAGG - Intronic
1196844294 X:119886321-119886343 CGGGCGGAGCAGTGGCTCAAGGG - Intergenic
1199608666 X:149595709-149595731 CCCAAGGCGCACTGGCTCAGGGG + Intergenic
1199630456 X:149773651-149773673 CCCAAGGCGCACTGGCTCAGGGG - Intergenic
1199759125 X:150891858-150891880 GCCTGGGAGGACTGGCTCAAGGG - Intronic