ID: 999959406

View in Genome Browser
Species Human (GRCh38)
Location 5:156737865-156737887
Sequence GGGTCCCCATCGCGAGTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999959400_999959406 5 Left 999959400 5:156737837-156737859 CCAACCCTCTCATTGTATACAGG No data
Right 999959406 5:156737865-156737887 GGGTCCCCATCGCGAGTTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 30
999959398_999959406 22 Left 999959398 5:156737820-156737842 CCCTTTCAATTGCTAGTCCAACC No data
Right 999959406 5:156737865-156737887 GGGTCCCCATCGCGAGTTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 30
999959399_999959406 21 Left 999959399 5:156737821-156737843 CCTTTCAATTGCTAGTCCAACCC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 999959406 5:156737865-156737887 GGGTCCCCATCGCGAGTTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 30
999959402_999959406 1 Left 999959402 5:156737841-156737863 CCCTCTCATTGTATACAGGAGAA No data
Right 999959406 5:156737865-156737887 GGGTCCCCATCGCGAGTTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 30
999959403_999959406 0 Left 999959403 5:156737842-156737864 CCTCTCATTGTATACAGGAGAAT 0: 1
1: 0
2: 3
3: 17
4: 167
Right 999959406 5:156737865-156737887 GGGTCCCCATCGCGAGTTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999959406 Original CRISPR GGGTCCCCATCGCGAGTTAG TGG Intronic