ID: 999960239

View in Genome Browser
Species Human (GRCh38)
Location 5:156747338-156747360
Sequence CCTGACCTACAGAAAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999960239_999960243 27 Left 999960239 5:156747338-156747360 CCTTTCATTTTCTGTAGGTCAGG 0: 1
1: 1
2: 3
3: 28
4: 237
Right 999960243 5:156747388-156747410 TGATTCAAGACTTTTTTATGAGG 0: 1
1: 0
2: 1
3: 27
4: 275
999960239_999960242 1 Left 999960239 5:156747338-156747360 CCTTTCATTTTCTGTAGGTCAGG 0: 1
1: 1
2: 3
3: 28
4: 237
Right 999960242 5:156747362-156747384 ATCAGGTGCAGCTTAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999960239 Original CRISPR CCTGACCTACAGAAAATGAA AGG (reversed) Intronic
901552687 1:10007727-10007749 CCTGGACAACAGAAAATGCAAGG + Exonic
902063457 1:13664737-13664759 CATGCCCTACAGAAATTGGAGGG - Intergenic
902128607 1:14239140-14239162 CATGACTTACGGAAAATGAGGGG - Intergenic
903725777 1:25443131-25443153 TATGACCTTCAGAATATGAAAGG + Intronic
906019926 1:42618892-42618914 TCTGGCCAACAGAATATGAATGG - Intronic
908783286 1:67711411-67711433 CCTGAGCTACAGAAAAGAATGGG + Intronic
908944817 1:69482520-69482542 ACTTACCTAGAGAACATGAAAGG - Intergenic
909298450 1:73981674-73981696 TCTGACCCACAGAAACTAAAAGG - Intergenic
910613224 1:89167277-89167299 CCTGAACTAGACAAAAAGAAGGG - Intronic
911147384 1:94565911-94565933 CCTGACATACAGTAATTGGAAGG - Intergenic
911352775 1:96774384-96774406 CCTGGAACACAGAAAATGAATGG - Intronic
912059516 1:105648595-105648617 CCTGACCCACAGAAAATGTGAGG + Intergenic
914464753 1:147917020-147917042 CCTGACCTACAGAAACTGTGAGG - Intergenic
914852032 1:151321906-151321928 ACTGTTCTAAAGAAAATGAAAGG + Intronic
915072836 1:153286305-153286327 CCAGAGCCACAGGAAATGAAAGG + Intergenic
916742350 1:167657276-167657298 CAAGACCTACAGAAAATCAGGGG + Intronic
918436337 1:184517071-184517093 ACTGACCTACAGTGAATGAATGG - Intronic
920549999 1:206851722-206851744 CCTGAACCACAGAAATTCAAAGG + Intergenic
923497229 1:234536199-234536221 CCTTAGCTAGAGAAAATAAAGGG - Intergenic
923820843 1:237439209-237439231 CCTGAGCTACAGAAAATGACAGG + Intronic
924907855 1:248475326-248475348 CCTGATTTACCGACAATGAATGG + Intergenic
924916254 1:248572756-248572778 CCTGATTTACCGACAATGAATGG - Intergenic
1064586478 10:16844292-16844314 CCAGACCTACAAAACAGGAAGGG + Intronic
1068546909 10:58357631-58357653 AATGACCTACAGAAAACAAAAGG - Intronic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1069248230 10:66235160-66235182 GCTGATCCACAGAAAATGAGAGG + Intronic
1071092150 10:81931161-81931183 CCTGACCTCCAGAAAAGTGAGGG - Intronic
1071129640 10:82376082-82376104 CCAGACCTACTGAAACAGAATGG - Intronic
1071380109 10:85050713-85050735 CCTTACCTACAGCAAGAGAAGGG - Intergenic
1072173712 10:92894431-92894453 CATTTCCTACAGACAATGAATGG + Intronic
1072178668 10:92956934-92956956 CCTGACTTACATACAGTGAATGG - Intronic
1073419512 10:103413099-103413121 CCTCACCTAGACAAAAGGAAGGG - Exonic
1073740465 10:106400457-106400479 CCTGCCCTACAAAACATCAAAGG + Intergenic
1073941891 10:108708860-108708882 GCTGAGATACAGAAAATGAGGGG - Intergenic
1075236177 10:120731339-120731361 CCTGAGCTACAGATAAAGAAAGG - Intergenic
1075319858 10:121482302-121482324 GCTGACCTTCAGAAGTTGAAAGG - Intronic
1075670155 10:124258946-124258968 CCTGACCTGCAGAAACTGTGTGG - Intergenic
1076656015 10:132023884-132023906 TCTGCTCCACAGAAAATGAACGG - Intergenic
1077385227 11:2266428-2266450 CCTGTCCTACAGGAAATACAGGG + Intergenic
1077591180 11:3492097-3492119 CCTGACCCACAGGAAAGGAGAGG + Intergenic
1080690512 11:34553283-34553305 CCTGACCTTCACAAAAGGAAAGG - Intergenic
1084499490 11:69526304-69526326 CCTGACCTCCAGCAAAGGAGAGG + Intergenic
1085984750 11:81772122-81772144 GCTGATATACAGAAAATGAAAGG + Intergenic
1088057902 11:105607925-105607947 CCTGATCTACAGAAAATTTTAGG - Intergenic
1088553076 11:111034374-111034396 TCTGTGCTGCAGAAAATGAATGG + Intergenic
1088934461 11:114385007-114385029 TCTGACCCACAGAAACTGTAAGG + Intergenic
1089082541 11:115788870-115788892 CCTGACCCACAGAAACTGTAAGG + Intergenic
1089220342 11:116865746-116865768 CATTTCCTCCAGAAAATGAAAGG + Intronic
1089628880 11:119771061-119771083 CCTGACCCACAGAAACTGTGAGG - Intergenic
1090294020 11:125570231-125570253 CCAGACTGACAGCAAATGAATGG - Intronic
1091107464 11:132936194-132936216 CCTGACCTTCAGGAACAGAAAGG + Intronic
1091348388 11:134871907-134871929 CCTGACCTCCAGGGAGTGAAGGG - Intergenic
1092417323 12:8300231-8300253 CCTGACCCACAGGAAAGGAGAGG + Intergenic
1093533272 12:20192771-20192793 CCTGACCTAAAGAAGCTGACAGG - Intergenic
1094255484 12:28420576-28420598 CATGACCCATGGAAAATGAAAGG + Intronic
1094809545 12:34124135-34124157 CCAGACCTACACAATATGTAGGG - Intergenic
1097336338 12:58387962-58387984 CCTGATCCACAGAAATTGTAAGG - Intergenic
1098881129 12:75918729-75918751 CCTGAGCTACAGAAAAAATAGGG - Intergenic
1100556068 12:95695186-95695208 ACTGAACTTCAGTAAATGAAAGG - Intronic
1101254509 12:102964357-102964379 CCAGATGAACAGAAAATGAAAGG + Intergenic
1102532521 12:113557314-113557336 CCTGACCCACAGAAACTGTGAGG - Intergenic
1102623236 12:114213711-114213733 CTTGCTCTACAGAAACTGAATGG - Intergenic
1102930364 12:116857430-116857452 TCTGACCTTCAGAAAAGAAATGG + Exonic
1104031915 12:125071005-125071027 CCTGACCCACAGAAACTCAGAGG - Intronic
1104179341 12:126363243-126363265 ACTGACCTACAGAAACTGTGAGG + Intergenic
1106627678 13:31437259-31437281 CCTTACCTACAAAATAAGAAAGG + Intergenic
1108504198 13:51095939-51095961 ACTGACCTACATAAAATGCCTGG - Intergenic
1108932254 13:55839830-55839852 TTTGACATACAGAAAATGTAGGG - Intergenic
1109281480 13:60361429-60361451 CCTGACCTACAGAAACTGAAGGG + Intergenic
1109344134 13:61094690-61094712 CCTGACTGACAGAGAAGGAATGG - Intergenic
1109800845 13:67376508-67376530 CCTGACAATCAGAATATGAAAGG + Intergenic
1110546453 13:76761394-76761416 CAAGACCTACTGAAAATAAATGG + Intergenic
1110717508 13:78723428-78723450 CCTAACCTATAGAAAAGGAGAGG - Intergenic
1111876255 13:93900217-93900239 TCAGACCTAAAGAGAATGAATGG + Intronic
1112322644 13:98421354-98421376 CCTACCCAAGAGAAAATGAAGGG - Intronic
1114248912 14:20940667-20940689 TTTGAACTAAAGAAAATGAAAGG + Intergenic
1114818737 14:25990955-25990977 CCTAACCTACTGAACATCAAAGG - Intergenic
1115036749 14:28866753-28866775 CCTGACCTACAGAACCTCAAAGG - Intergenic
1117291946 14:54343069-54343091 CCTGACTTAGAGACAATGTAAGG - Intergenic
1122429789 14:101633110-101633132 CCTGACCTAAAGAAAGAGGAAGG + Intergenic
1122496433 14:102159245-102159267 CATGACCCATAGAAAATGAGTGG - Intronic
1128991261 15:72262388-72262410 CCTTACCTCCAGAGAATGGAGGG - Intronic
1129883312 15:79021182-79021204 CCTGACCCACAGAAATTGTGAGG + Intronic
1130969569 15:88721386-88721408 CATCACCTACACAAAAGGAAGGG + Intergenic
1131490647 15:92859495-92859517 CATGGCCATCAGAAAATGAAGGG + Intergenic
1133356549 16:5141130-5141152 CCTGACCCACAGGAAAGGAGAGG + Intergenic
1135570316 16:23544400-23544422 CCTGACCCACAGAAACTGAGAGG + Intronic
1136028186 16:27483571-27483593 CTTGCCCAAAAGAAAATGAAGGG + Intronic
1137667549 16:50260567-50260589 CCTGACCTACAGAAATTATGAGG - Intronic
1138060128 16:53881335-53881357 CTTGACCTACAGCAAAAGACAGG - Intronic
1139291987 16:65867624-65867646 CCAGACCTACAGAATGGGAATGG - Intergenic
1139546528 16:67652526-67652548 CCTGACTTACTGTGAATGAAGGG - Exonic
1141965586 16:87440610-87440632 CCTGTCAAAAAGAAAATGAAGGG - Intronic
1143255122 17:5551421-5551443 GCTGCCCTTCAGAAAGTGAATGG - Intronic
1148406104 17:47417830-47417852 CCTGACAGAGAGAACATGAAAGG - Intronic
1149573587 17:57695456-57695478 CCTCATCTTCAGAAAATGGAGGG - Intergenic
1149753054 17:59164496-59164518 CCTGGGCAACAGAAAAAGAATGG + Intronic
1150346234 17:64406618-64406640 CTTGACCTATAGAGAGTGAAGGG - Intronic
1151046407 17:70924897-70924919 CATGACAGACAGAAAATGAAGGG - Intergenic
1151980090 17:77503474-77503496 CCTGAGCTCCAGAGAATGCAGGG - Intergenic
1152236967 17:79143818-79143840 CCTCACCGACTGAAAATGGAGGG - Intronic
1152521659 17:80860059-80860081 CCTGCCACACAGAAAAGGAAAGG - Intronic
1152607517 17:81300215-81300237 CCTGACCCACAGAATAAGATAGG - Intergenic
1153908968 18:9689757-9689779 GGTGACATACAGAAAATGGAAGG - Intergenic
1154151698 18:11911094-11911116 CCTGACCTACAGGACTTGTACGG + Intergenic
1154282523 18:13017514-13017536 CCTCACCTACAGAAAATTAAAGG + Intronic
1154377258 18:13820617-13820639 CCTTACTTAGAGAAAAGGAAAGG - Intergenic
1157472441 18:48000077-48000099 TCTCACCAACAGAAAATGAGTGG + Intergenic
1158681776 18:59574387-59574409 CCACACTTACAGGAAATGAATGG + Intronic
1160008100 18:75083204-75083226 CCTGACCCACAGCAATTGTAAGG - Intergenic
1162187890 19:8920386-8920408 CCTAACCTACAGAACATGATAGG + Intronic
1164254606 19:23516473-23516495 CCTGAACAATAGAAACTGAAAGG - Intergenic
1165549364 19:36570777-36570799 CTTGATTTACAGAAAATGTATGG + Intronic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1166023377 19:40054619-40054641 CCTGTCCTATAGAAAGTCAAGGG + Intronic
1166056546 19:40293040-40293062 CCTGACCTGCAGAAAAGAAGAGG - Intergenic
1166057937 19:40304612-40304634 CCTGAGCTACAGAAAAAAGAGGG - Intergenic
1166434888 19:42758936-42758958 AATGACCTACAGAGAGTGAAGGG + Intronic
1167415160 19:49366235-49366257 CCTAAACTACAGAAAATGTTAGG - Intronic
925857901 2:8148366-8148388 CCTGACTTACAGAAGCAGAAAGG + Intergenic
926857291 2:17270946-17270968 CTTTACCTCCAGAAAAGGAAGGG - Intergenic
927461097 2:23298734-23298756 CCTGACACGCAGAAAATAAAGGG + Intergenic
929393962 2:41500957-41500979 CTTGTCCTAAAGAAAATGACTGG + Intergenic
931077754 2:58735599-58735621 CCTGAAGTAGAGAAACTGAAAGG - Intergenic
931311053 2:61080934-61080956 TCAGACATACAGAAAAAGAAAGG - Intronic
931969093 2:67566408-67566430 CCTGACCCACAGAAACTGTAGGG - Intergenic
932630843 2:73341940-73341962 TCTGAGCTACAGAAACTGTATGG + Intergenic
933175780 2:79171056-79171078 CCTGCTATACAGAAAATGAGGGG + Intergenic
933462302 2:82603781-82603803 TTTGACCTACAGAAACTCAAAGG + Intergenic
939204100 2:139077571-139077593 CCTGAGCTATTGAAAATGAATGG + Intergenic
939423726 2:142007494-142007516 ACTCACCTACAGAATACGAATGG + Intronic
939685077 2:145189119-145189141 CCTGACCTGCAGAAATTGTGAGG + Intergenic
939966316 2:148613779-148613801 CCTGAGCTACAGAAAGAGACTGG + Intergenic
940136974 2:150447990-150448012 CCTGACCTCCAGAAAGAGGAGGG - Intergenic
940793830 2:158055941-158055963 CCTGGCATACAGTGAATGAATGG + Intronic
943328261 2:186527536-186527558 GCTGATATACAGAAAATAAAAGG - Intergenic
943548425 2:189309901-189309923 CCTGGTCAACAGAATATGAATGG - Intergenic
945148605 2:206764719-206764741 CTTGACCTACATGAAATGCAAGG + Intronic
946846106 2:223860276-223860298 TCTGACCTAGAGAAAATAGAAGG + Intronic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
947791115 2:232870005-232870027 CCTGGACCACTGAAAATGAAAGG - Intronic
947960448 2:234232100-234232122 CCTGACCTCCAGACAAGGAAGGG - Intergenic
1169813140 20:9629208-9629230 CCTGACCCATAGAAACTGCAAGG + Intronic
1169920492 20:10730067-10730089 CTTGACCTACAGATAATTAAAGG - Intergenic
1170183256 20:13557127-13557149 CCTGATCTCCACAAAAAGAATGG + Intronic
1170837742 20:19899509-19899531 TCTGACCCACAGAAAATGTGAGG - Intronic
1171162503 20:22941003-22941025 TCTGATCTACAGAAACTGTAAGG - Intergenic
1172674165 20:36655597-36655619 CCTGACCTAGAGAAATGAAATGG - Intronic
1173325966 20:42034080-42034102 CCAGACCCACAGAAACTGCAAGG - Intergenic
1174575138 20:51531948-51531970 GCTGACCTTCAGAAAATGTGTGG + Intronic
1175600213 20:60266872-60266894 CCTTAGCTGCAGCAAATGAAGGG - Intergenic
1177394918 21:20521536-20521558 TCTGACCTACAGAACCAGAATGG - Intergenic
1177537429 21:22446749-22446771 CCTGAACTACACAAAAAGTAGGG + Intergenic
1179478747 21:41664711-41664733 CCTGACCTCCAGAAAATTCAAGG - Intergenic
1182174988 22:28275929-28275951 ACTGATCTACAGAAAGTGACAGG + Intronic
1182965150 22:34514547-34514569 ACTGAGCTACAGGGAATGAAAGG + Intergenic
1183969346 22:41464945-41464967 CATGACCTAAAGAAAAGGAGAGG + Intronic
1185306624 22:50121227-50121249 CCTGTCCTAAGGAGAATGAAGGG + Intronic
951667300 3:25141565-25141587 TCAAATCTACAGAAAATGAAAGG + Intergenic
953051569 3:39349051-39349073 CCTGAGCTACTCCAAATGAAAGG + Intergenic
954766337 3:52920357-52920379 CCTGACCCACAGAAACTGTAAGG + Intronic
956033238 3:65062134-65062156 CCTGCCCTCTAAAAAATGAAGGG + Intergenic
957061201 3:75482603-75482625 CCTGACCCACAGGAAAGGAGAGG + Intergenic
957118779 3:76061853-76061875 CCTGTCGGACAGAAAAAGAAAGG - Intronic
959002199 3:100977333-100977355 CCTGATCCACAGAAACTGTATGG - Intronic
959367691 3:105483479-105483501 AGTGACCTAAAGAAAATGTACGG + Intronic
959630578 3:108502850-108502872 CTTGAAATACAGAAAGTGAAGGG - Intronic
961292191 3:125856813-125856835 CCTGACCCACAGGAAAGGAGAGG - Intergenic
961706971 3:128794557-128794579 AGTGACTTCCAGAAAATGAATGG - Intronic
961895004 3:130159583-130159605 CCTGACCCACAGGAAAGGAGAGG + Intergenic
962886560 3:139633136-139633158 TCTGACCTACAAAACTTGAAGGG + Intronic
963935405 3:151047071-151047093 TCTGACCTACAGATAATCAATGG + Intergenic
964430409 3:156599725-156599747 GCTGACCTAAATAAAATGCAGGG + Intergenic
964910421 3:161773902-161773924 CTTGATCTACAGATAATGAAGGG + Intergenic
965214590 3:165845966-165845988 CCTCACCTAGAGAACAAGAAGGG + Intergenic
968679613 4:1908089-1908111 CCTGAAGTACAGAAAAAGACAGG - Intronic
969005105 4:4012642-4012664 CCTGACCCACAGGAAAGGAGAGG + Intergenic
969747759 4:9087511-9087533 CCTGACCCACAGGAAAGGAGAGG - Intergenic
969808799 4:9632029-9632051 CCTGACCCACAGGAAAGGAGAGG - Intergenic
972131115 4:35834420-35834442 GCTGACCTTGAGAAACTGAATGG - Intergenic
973154478 4:46932882-46932904 CATGACATACAAATAATGAATGG - Intronic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
975489795 4:74976061-74976083 CCTGATCCACAGAAAAAGCATGG - Intronic
977216396 4:94289461-94289483 TCTGACCTACAGGTGATGAAGGG + Exonic
978343517 4:107741537-107741559 CATGTTCCACAGAAAATGAAAGG + Intergenic
978476504 4:109137058-109137080 CCTGACCCACAGAAACTGTGAGG + Intronic
978709642 4:111764027-111764049 CTTGACCAACAGAAAAAAAATGG + Intergenic
980617481 4:135249770-135249792 TGTTAACTACAGAAAATGAAAGG + Intergenic
981265441 4:142777576-142777598 CCTGACCCACAGAAACTGTGAGG + Intronic
981931887 4:150198916-150198938 CCTGCCCTACAGAAAGTGGGGGG - Intronic
983019785 4:162661288-162661310 AGTGACATACAGAAAATGGAAGG + Intergenic
983493516 4:168416902-168416924 CCTAACCTAAATAAAGTGAATGG + Intronic
987809383 5:22813916-22813938 CCTGACCCACAGAAACTGTGAGG + Intronic
988330668 5:29835759-29835781 ACTGACCTACAATAAATGAGTGG + Intergenic
988613723 5:32752791-32752813 CTTTAGCTAGAGAAAATGAATGG - Intronic
990869220 5:60413430-60413452 TCTCATCTTCAGAAAATGAAAGG - Intronic
991093957 5:62719847-62719869 CCTGACGTACAGTAAAAAAAAGG - Intergenic
991282329 5:64929346-64929368 CCTGTTCTACAAAAAAAGAAAGG + Intronic
994495061 5:100501705-100501727 CATGACCTACTGAAACTGACTGG + Intergenic
995556102 5:113330666-113330688 CCTCCCCTACACAAAAGGAAAGG + Intronic
997270685 5:132535164-132535186 CCTTACCAAAAGAAAATGATAGG + Intergenic
997457685 5:134029302-134029324 CCTGACCTACAGAAAATATGTGG + Intergenic
999960239 5:156747338-156747360 CCTGACCTACAGAAAATGAAAGG - Intronic
1000366945 5:160500551-160500573 CCGGACCTACAGAAATTGTGGGG + Intergenic
1001455439 5:171856596-171856618 CCTGAGCTAGAAAAAAAGAACGG + Intergenic
1002674371 5:180898765-180898787 CCTGAACTTCAGAGAATGGAGGG + Intergenic
1007839775 6:44706285-44706307 CCTGCCTTACAGAGAATCAAGGG - Intergenic
1009971069 6:70626308-70626330 CTTGACTTACAGAAATTAAAAGG - Intergenic
1010371530 6:75115384-75115406 TCCGACCTCTAGAAAATGAAAGG - Intronic
1010573231 6:77503364-77503386 CCTGACCTACAGAAACAGTGTGG + Intergenic
1013548854 6:111187479-111187501 CCTGCCCTACAAAAAAAGAAAGG + Intronic
1014740036 6:125138720-125138742 CCTGACCTACAGAAAGGAATAGG - Intronic
1014853137 6:126365809-126365831 TCTGACCCACAAAGAATGAAAGG + Intergenic
1015528137 6:134193087-134193109 CCTGACTTAGAGAAAATAAATGG - Intronic
1017760170 6:157562442-157562464 CCCCACCAACAGAAAATGAGGGG - Intronic
1019063893 6:169279204-169279226 ACATATCTACAGAAAATGAACGG - Intergenic
1019842081 7:3457201-3457223 CCTGACCTACAAACAACCAAAGG - Intronic
1020325242 7:6969124-6969146 CCTGACCCACAGGAAAGGAGAGG + Intergenic
1022428385 7:30290342-30290364 CTTGACCCACAGAAATTGCAAGG - Intronic
1024236870 7:47405554-47405576 CATGACCTAAAGCAATTGAAAGG + Intronic
1028538642 7:91917671-91917693 CCTGACCTTCAGAAAAGGAATGG + Intergenic
1028831303 7:95329197-95329219 CCTGGCCCACAGAAAGTGAGAGG - Intergenic
1028980654 7:96964542-96964564 CCTGAAATAGAGAAAATAAAGGG - Intergenic
1030786429 7:113669016-113669038 CCAAACCTAAAGAAAATGGAAGG + Intergenic
1030907235 7:115201432-115201454 TCTGAACCACAGAAATTGAAAGG - Intergenic
1032746068 7:134787539-134787561 CCTGCCCTAGAGAAGATGTAGGG - Intronic
1033031391 7:137830714-137830736 CCTGTTATACAGAAAAGGAAAGG + Intronic
1033523380 7:142185060-142185082 CCAAACCTAGAGAAAAAGAAGGG - Intronic
1033903186 7:146168426-146168448 CCTATCCTACAGATAATGTAAGG + Intronic
1036370826 8:8161699-8161721 CCTGACCCACAGGAAAGGAGAGG - Intergenic
1036880067 8:12503937-12503959 CCTGACCCACAGGAAAGGAGAGG + Intergenic
1036912587 8:12769652-12769674 CCAGACCTTCAAAAAATGTAAGG - Intergenic
1037379290 8:18267069-18267091 CCTGACTTACAGAAATTGCAAGG + Intergenic
1037487623 8:19363550-19363572 CCTGACAGACAAAAAATTAAAGG - Intronic
1038061272 8:23916138-23916160 CCTTACCTATAGAGAAAGAAAGG - Intergenic
1041202764 8:55466978-55467000 CCTGACCCACAGAAACTGTGAGG - Intronic
1041691333 8:60690864-60690886 ACTGAGCTGCAGAAAATGACAGG - Intronic
1042092303 8:65172273-65172295 CCTAAGCTACAAAAAATGAAGGG - Intergenic
1042722154 8:71838044-71838066 CCTGACTTACAGAAGAGGTAAGG + Intronic
1043015710 8:74938572-74938594 CCTGTCCTACAAGAAATGATAGG - Intergenic
1043019762 8:74985335-74985357 CGTGAACTACTGCAAATGAATGG - Intronic
1043157492 8:76802253-76802275 TATTACCTACAGAAAATCAAAGG + Intronic
1044438749 8:92197760-92197782 CATTACCTAAAGAATATGAAAGG + Intergenic
1044742478 8:95342165-95342187 TCTCACCAACAGAATATGAATGG - Intergenic
1046867510 8:119167246-119167268 AGTGACGTACAGAAAATGGAAGG + Intronic
1047154897 8:122305960-122305982 CCTGAGATACAGCAAAGGAAAGG - Intergenic
1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG + Intronic
1051502095 9:17789046-17789068 CATGCCCTACACACAATGAAAGG - Intronic
1056037252 9:82619569-82619591 CCTGACCCACAGAAACTATAAGG + Intergenic
1058835074 9:108853477-108853499 CCTGACCCACAGTACATGCATGG + Intergenic
1061112219 9:128582118-128582140 CCTGACCTACTTTTAATGAAGGG - Intronic
1186148962 X:6654089-6654111 CCTGCCTTACAGAAAATGCTGGG - Intergenic
1187869211 X:23750455-23750477 CTTGACCCACAGAAACTGTAAGG + Intronic
1187869681 X:23754195-23754217 CCTGAACTCAAGAAAATGGAAGG - Intronic
1188030660 X:25260032-25260054 CCTGGCCTTCAGAAACTGCATGG - Intergenic
1188249032 X:27869020-27869042 CCAGACCTACAGAAACTGTATGG + Intergenic
1188565633 X:31523213-31523235 CATGACCTCCAGAAGATTAAGGG - Intronic
1188653445 X:32660504-32660526 CTATACCTACAGAAAATAAATGG - Intronic
1189950077 X:46220131-46220153 CCTGACACACAGAAACTAAAAGG + Intergenic
1189981469 X:46514983-46515005 ACTGACCCTCAGAAATTGAAAGG + Intronic
1190143636 X:47870504-47870526 CCTGAACAACAGAAAATAAAAGG + Intronic
1190145166 X:47884367-47884389 CCTGACCTACAGAAACTGTGAGG - Intronic
1192292085 X:69808902-69808924 CCAAACCTAATGAAAATGAATGG - Intronic
1197188636 X:123619431-123619453 ACTGTCCTGTAGAAAATGAATGG + Exonic
1197497065 X:127196980-127197002 CCTAACCTGTAGTAAATGAATGG - Intergenic
1197848138 X:130826419-130826441 TCTGAGGCACAGAAAATGAATGG - Intronic
1198974097 X:142315718-142315740 CCTGACCAACAGAAACTGTGAGG + Intergenic
1199545801 X:149006400-149006422 CCTGACCCACCGAAACTGAGAGG - Intergenic
1199722730 X:150553849-150553871 CCTGGGCTACAGACCATGAAGGG - Intergenic
1200095846 X:153661504-153661526 ACTGACCTATAGAAATTTAAAGG + Intergenic