ID: 999961063

View in Genome Browser
Species Human (GRCh38)
Location 5:156756081-156756103
Sequence GTTCCTTTTTAACATGTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 353}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999961063 Original CRISPR GTTCCTTTTTAACATGTTTA AGG Intronic
901590196 1:10334884-10334906 GCTGTTCTTTAACATGTTTAAGG - Intronic
901630392 1:10645222-10645244 GCTGCTTTTTAACATGTGAAAGG - Intronic
901790793 1:11652943-11652965 CTTCCTTATTAACATTTTTTTGG + Intronic
903988663 1:27248955-27248977 GTTTCTTTTTAAAAAATTTAAGG - Intronic
905155280 1:35973073-35973095 TTTACTTGTTAACATTTTTAAGG + Intronic
905306621 1:37023617-37023639 TTTTCTTTTTAATGTGTTTATGG + Intronic
908547358 1:65174929-65174951 TTTTCTTTTTAAAATTTTTATGG + Intronic
908878359 1:68702987-68703009 TTTGCTTTTGAACATGTTAAGGG - Intergenic
909887475 1:80960589-80960611 TTTCTTTTTTAACCTGTTTGCGG - Intergenic
910050818 1:82972470-82972492 GTTTCTTTTTATCATTTTTCAGG + Intergenic
910186633 1:84548358-84548380 GTTACTTTTTCCCATGATTATGG - Intergenic
910375877 1:86569782-86569804 GTTCAATTTTACAATGTTTATGG - Intronic
910772385 1:90843151-90843173 GTTCCTATTTAATATGTTTAAGG + Intergenic
911132933 1:94409006-94409028 GTTCCTTTTTATAACTTTTAAGG + Intergenic
912637447 1:111310991-111311013 TTTAATTTCTAACATGTTTATGG - Intronic
912831052 1:112954573-112954595 TTTCCTTTTTAATCTGTTTAAGG + Intronic
914986420 1:152461099-152461121 ATCCCTTTTTAAGATTTTTAGGG + Intergenic
917332510 1:173896242-173896264 GTTCATTCTTAACATGTTAAGGG + Exonic
918719264 1:187831610-187831632 GTTATGTTTTAAAATGTTTAAGG + Intergenic
922546168 1:226458635-226458657 GTTTTTGTTTAACATGTTGAAGG + Intergenic
1062843431 10:688392-688414 TTTCCTTTTTAACACTTTCAGGG - Intronic
1063588592 10:7374999-7375021 TTTCCTTGATAAAATGTTTATGG - Intronic
1063610248 10:7555611-7555633 TTTACTTTTTAACATTTATAGGG + Intergenic
1063934242 10:11060639-11060661 TTTCCTTTTTAACAAATTGAAGG + Intronic
1063934681 10:11065648-11065670 ATTCCTTCAAAACATGTTTATGG + Intronic
1063991133 10:11564868-11564890 GTTACTTTGTATCATGTTAATGG - Intronic
1064416502 10:15154554-15154576 TTTCCTTTTTCACAATTTTATGG + Intronic
1065138191 10:22693327-22693349 ATTCTTTGTTAACATTTTTAAGG + Intronic
1065425595 10:25599508-25599530 TTTCCATTTCAGCATGTTTAAGG + Exonic
1065576374 10:27123606-27123628 GTTCCTTTTTATTATGCTTCTGG - Exonic
1067151400 10:43737957-43737979 ATTCCTTTTTAACAAGTTTGTGG + Intergenic
1067527218 10:47046093-47046115 GTTCCCTTTTAACATATTCTTGG - Intergenic
1067669130 10:48303644-48303666 GTTCCTTGTTAACCTATTAAGGG - Intergenic
1068439699 10:57035782-57035804 TTTTATTTTTAAAATGTTTAGGG + Intergenic
1068582350 10:58756078-58756100 GTTCCATTTTCACTTGTTTCTGG + Intronic
1068866352 10:61899445-61899467 GTTCATTTTTAACATATGAATGG - Intergenic
1069179203 10:65334765-65334787 GTTCCATTGTAACATTTTGAAGG + Intergenic
1069629035 10:69886598-69886620 GCTCCTTTCTACCATGTTCAAGG - Intronic
1069973267 10:72191600-72191622 TTTTCTTTTTAGAATGTTTATGG - Intronic
1070478631 10:76856510-76856532 GCTTCTTTTTAACATTTTTGTGG + Intergenic
1071774585 10:88771119-88771141 TTTGCTTTTAAAAATGTTTATGG + Intronic
1073611991 10:104953483-104953505 ATTCCTATTTAAGATGTCTAAGG + Intronic
1074157127 10:110808893-110808915 GATGCTTTTTAACATTTGTATGG + Intronic
1074971187 10:118540477-118540499 GTTCTTTTTTCACAAGTTTTAGG + Intergenic
1076057595 10:127388344-127388366 GTTCCTTTTTAACATTCTCGTGG - Intronic
1077826188 11:5810426-5810448 ATTCCATTTTAAAATGTTTTGGG - Intronic
1080271681 11:30457183-30457205 GTTCCTTTAGAACATGTCCAGGG - Intronic
1080568870 11:33537682-33537704 GTTTCTTTTTCACATGTTTTAGG + Intergenic
1080759104 11:35230519-35230541 GATCCTGTTTGACATTTTTATGG + Intronic
1081300725 11:41447928-41447950 GTATGTTTTTAACATCTTTAAGG + Intronic
1081422684 11:42890041-42890063 ATTCCTTTTTAAGATTTTTGTGG - Intergenic
1081940877 11:46940593-46940615 GTGCCTTTTTACCAAGTTTAAGG + Intronic
1081961508 11:47141075-47141097 GTTTCTTTTTAACAGCTTTTTGG + Intronic
1082105748 11:48219515-48219537 GTTCCTTTTGAACACTTTCATGG + Intergenic
1082172665 11:49024964-49024986 GTTACTTTTTAAATTGTTTGTGG - Intergenic
1082201732 11:49379833-49379855 GTTCCTCTTTAAATTGTTTTTGG + Intergenic
1084469602 11:69349321-69349343 TTTCCTTTTTAAAAAGTTTTTGG + Intronic
1084965226 11:72741131-72741153 CTTCCTGTTTACCATGTTTTGGG + Intronic
1085539676 11:77255136-77255158 GCTCTGTTTTAGCATGTTTAGGG - Intronic
1085953600 11:81364002-81364024 GTTCCTTTTGAAAGTGTTTTAGG + Intergenic
1086514760 11:87598835-87598857 GATCCTGTTTAACATTTTTATGG + Intergenic
1086653945 11:89326393-89326415 GTTCCTCTTTAAATTGTTTTTGG - Exonic
1087567718 11:99883539-99883561 CTTCCTTGTTAACATGCTCATGG + Intronic
1087669813 11:101092662-101092684 GTGCCTTATTAACATATTTGTGG - Intronic
1088046997 11:105465351-105465373 GTTCCTTTTTTACAATTGTAAGG - Intergenic
1088359557 11:108976539-108976561 GCACCTTTTTAGCATATTTAGGG + Intergenic
1089106719 11:116013798-116013820 GTTCTATTTTAAAATGTTTGAGG + Intergenic
1089724251 11:120460773-120460795 GTTTCTTTTTAATATTTTTATGG + Intronic
1090163886 11:124525353-124525375 GTTCTATTTTAACATTTTTGAGG - Intergenic
1090720525 11:129468072-129468094 GCTCCTTTTTCTCATGTTCATGG - Intergenic
1091068528 11:132541259-132541281 CTTCCTCTTTAACATGGTCATGG + Intronic
1091526233 12:1304054-1304076 GTTTCTTTTTAACCTATTTAGGG + Intronic
1091702301 12:2671900-2671922 TTTCGATTTTAACAAGTTTATGG - Intronic
1092883153 12:12903585-12903607 GTTCCTTTTAAACATTATTTAGG - Intronic
1093100201 12:15018872-15018894 CTTACTTTTTAATAGGTTTAAGG - Intergenic
1093173900 12:15889456-15889478 ATTCCCTTGTAACATTTTTAAGG + Intronic
1093263317 12:16968470-16968492 TTTCCTTTTTAAAATGTGAATGG - Intergenic
1093334357 12:17883399-17883421 TTTCCTTATTAACATGGTTGGGG + Intergenic
1093718517 12:22411447-22411469 GTCCCTTGTTAAAATTTTTAGGG - Intronic
1093763579 12:22937584-22937606 GGGCCTTCTTAACATGGTTAAGG - Intergenic
1093784666 12:23178265-23178287 GTTCCTGTTTAATATTTTTCAGG + Intergenic
1094806059 12:34093435-34093457 GTTATTTTTCAATATGTTTAAGG + Intergenic
1094816268 12:34188383-34188405 ATTCTGTTTTAACATATTTAGGG + Intergenic
1097551237 12:61073503-61073525 TATTCTTTTTAACTTGTTTAAGG - Intergenic
1099731722 12:86512355-86512377 GTTATATTTTAAAATGTTTAAGG - Intronic
1105354684 13:19648640-19648662 TTTCCTTTTTAATATGATGAGGG + Intronic
1105619639 13:22054265-22054287 TTTCCTTTTTAAAAATTTTATGG - Intergenic
1105911773 13:24875284-24875306 TTTGCTTTATAAAATGTTTATGG + Intronic
1106833363 13:33609169-33609191 TTTCCTTTTTACTTTGTTTATGG - Intergenic
1107813816 13:44226016-44226038 GTTCCATTCTACCATCTTTATGG + Intergenic
1108931700 13:55832016-55832038 CTTCATTTTTAACATTTTCAGGG + Intergenic
1109145940 13:58779846-58779868 TTTCCTTTTTATTATGTTAATGG - Intergenic
1109232892 13:59780814-59780836 TTTCCTTTTGGACATGTTAATGG + Intronic
1109628451 13:65010919-65010941 GTGCATTTTTAACAACTTTATGG + Intergenic
1109810465 13:67507187-67507209 TGGCCTTTTTGACATGTTTATGG - Intergenic
1109847117 13:68008320-68008342 TGTCATTTTTAATATGTTTATGG + Intergenic
1109924357 13:69115627-69115649 TTTTCTGTATAACATGTTTACGG + Intergenic
1110058441 13:71008752-71008774 TTTCAGTTTTAACTTGTTTATGG + Intergenic
1110619982 13:77584563-77584585 CTTCCATTTTAAAATGTCTAGGG - Intronic
1111066512 13:83100954-83100976 TTTCCTATTTGACATATTTAAGG - Intergenic
1111096627 13:83523935-83523957 GTTTCTTGTTAACAGGATTAAGG + Intergenic
1112079522 13:95953940-95953962 TTTCCTTTTGAGCATGCTTAGGG - Intronic
1112765219 13:102734616-102734638 TTTCATTTTTAACATCTTTTGGG + Exonic
1113004497 13:105683965-105683987 ATCCATTTTTAACATGTTTGTGG + Intergenic
1113284701 13:108833883-108833905 TTTCTTTTTTAAAATGTTTATGG + Intronic
1114073714 14:19137591-19137613 GTTCCCATCTCACATGTTTAAGG + Intergenic
1114088550 14:19262394-19262416 GTTCCCATCTCACATGTTTAAGG - Intergenic
1115171330 14:30510925-30510947 TTTATTTTTTAAAATGTTTATGG - Intergenic
1116267676 14:42715255-42715277 GTTCTTTTTTAAATTGTTTGAGG + Intergenic
1116665477 14:47768627-47768649 GTTATATTTTAACATCTTTAGGG - Intergenic
1117711554 14:58534846-58534868 CTTCCATTTTAACTTTTTTATGG + Intronic
1120290219 14:82559621-82559643 GTTATCTTTTAAAATGTTTATGG + Intergenic
1120456284 14:84734893-84734915 GTTACTTTTTGAAATATTTATGG - Intergenic
1121435131 14:93914177-93914199 GTTTCTTTTAAAAATGTTTCTGG - Intergenic
1123437280 15:20263944-20263966 ATGCCTTTATAACATGGTTAAGG - Intergenic
1123925138 15:25101554-25101576 GTTCCTTTTTAAAATGTGCCTGG + Intergenic
1125139321 15:36385614-36385636 GATCATTTTTAAAATGTTTCTGG - Intergenic
1125417475 15:39468429-39468451 TTTCCTTTGGAACATGTTTAAGG - Intergenic
1126478220 15:49089661-49089683 GCTTCTTTTTATCATGTCTAAGG + Intergenic
1127430251 15:58899599-58899621 CTTCCTTCTTACCATCTTTATGG + Exonic
1127828503 15:62727689-62727711 GTTCCTTATAGAGATGTTTAAGG - Intronic
1130120069 15:81040332-81040354 GTTCCTGCTTAACATGATTTGGG - Intronic
1131444445 15:92485578-92485600 ATTCCTTTTTATCATTTTAATGG - Intronic
1132317921 15:100903390-100903412 GATTCTTTTTCACATGTGTATGG + Intronic
1132614667 16:834547-834569 GTTCCTTTTCAAGATGATTTTGG - Intergenic
1133887374 16:9843177-9843199 TTTTCTTTTTTACATTTTTAGGG + Intronic
1134456627 16:14400019-14400041 GATCCTTTTTTACCTGATTACGG + Intergenic
1134883063 16:17764134-17764156 GCACCTTTTCAAAATGTTTATGG - Intergenic
1135480317 16:22815853-22815875 GTGCCTTTTTTACACCTTTAAGG - Intronic
1136847289 16:33586888-33586910 ATGCCTTTATAACATGGTTAAGG + Intergenic
1137607786 16:49798043-49798065 GTTACTTTTTAAATTTTTTATGG - Intronic
1137764092 16:50964329-50964351 GTTCCTCTTTAAAAAGTTTATGG - Intergenic
1138214373 16:55190375-55190397 GTTGCCTTTTCACATGTTTATGG + Intergenic
1139368704 16:66451176-66451198 GTTCCTTCTTCACGTCTTTATGG - Intronic
1140589318 16:76332736-76332758 TTTCCTTTTTATCATATTCAGGG + Intronic
1140781116 16:78297803-78297825 GTTTCCTTGTACCATGTTTAAGG - Intronic
1203108997 16_KI270728v1_random:1435543-1435565 ATGCCTTTATAACATGGTTAAGG + Intergenic
1143311238 17:5991355-5991377 TTTGCTTATTAACTTGTTTAAGG - Intronic
1143957331 17:10681657-10681679 GTCTGTTTGTAACATGTTTAGGG - Intronic
1144327082 17:14192790-14192812 GCTCATTTTTACCATGTGTAAGG + Intronic
1145325486 17:21820153-21820175 TTTCCCTTATAACATGTTTCTGG - Intergenic
1146204706 17:30892668-30892690 GTTTCTTTTTAGTATTTTTAGGG - Exonic
1146977337 17:37125447-37125469 CTTCCTTTTTATAATGTTTCAGG - Intronic
1148729162 17:49820577-49820599 TTTACATTTTAAAATGTTTAAGG - Intronic
1148939900 17:51199401-51199423 TTTTCTTTTTAACATGATCAAGG + Intronic
1149448104 17:56729426-56729448 GTTCCTTTCTAACATGTCCCTGG - Intergenic
1150355686 17:64482616-64482638 TTTGCTTTTTAAAATGTTTTAGG - Intronic
1153196340 18:2601859-2601881 GTTTCTTTTTACCAAGTTTTTGG + Intronic
1154043464 18:10882067-10882089 GTGCCTTCTTAACTTGTTGAGGG + Intronic
1154489659 18:14910096-14910118 TTTCATTTTTAATATATTTAGGG + Intergenic
1155397434 18:25401577-25401599 GTTCTTATTCAACATGTTAAGGG - Intergenic
1155801276 18:30106855-30106877 GCTCCATTTTAACAAATTTATGG - Intergenic
1155838366 18:30615325-30615347 GTTCCTTTTCAAAATGTTTTTGG - Intergenic
1156685939 18:39646708-39646730 GTTTCTTTTTTACTTTTTTAGGG + Intergenic
1157797733 18:50590533-50590555 GTTCCTCATTAACTTGTATAAGG - Intronic
1158022185 18:52856275-52856297 ATGTCTTTTTAAGATGTTTATGG + Intronic
1158819849 18:61146963-61146985 CTAACTTTTTAACATGTTTCTGG - Intergenic
1159733396 18:72061365-72061387 GTTCCTTGTTAACATCGTTCTGG + Intergenic
1164150422 19:22545738-22545760 GTTATTTTTTAACAGCTTTATGG - Intergenic
1164520902 19:28978614-28978636 GTTCCATTTTTACATGTTGATGG - Intergenic
1165033268 19:33013826-33013848 ATGCCTTTATAACATGGTTAAGG - Intronic
1168546093 19:57251104-57251126 GTTCATCTTTCACATGTGTAGGG + Intronic
927743518 2:25593510-25593532 TTTCTTTTTTAACATTTTCATGG + Intronic
929058429 2:37899408-37899430 TTTCCATTTTAACAAGTTTGGGG - Intergenic
929320987 2:40543182-40543204 ATTCCTTTTAAACATCTTGAAGG - Intronic
929471128 2:42194040-42194062 TTTCCCTTTTACCATTTTTAGGG + Intronic
931279217 2:60773870-60773892 GTTCCTTTTGTCCATTTTTAAGG + Intronic
931302633 2:60995808-60995830 GTTTCTTTTAAAAATGTGTATGG - Intronic
931759635 2:65405452-65405474 ATTCCTAGCTAACATGTTTAAGG + Intronic
933260943 2:80130779-80130801 GTTGCTTTTTAAAATGTTAATGG + Intronic
933915229 2:86984882-86984904 TTTTCTTTTTAAATTGTTTAGGG + Intronic
934007764 2:87785019-87785041 TTTTCTTTTTAAATTGTTTAGGG - Intronic
934914181 2:98285695-98285717 GTTCTTTTTCAACATTTTTTGGG + Intronic
935408435 2:102734531-102734553 GTTTTTTTTTGACATATTTAGGG - Intronic
935771402 2:106425938-106425960 TTTCCTTTTTAAATTGTTTAGGG - Intronic
935908671 2:107870011-107870033 TTTCCTTTTTAAATTGTTTAGGG + Intronic
935995076 2:108762229-108762251 TTTCCTTTTTAAATTGTTTAGGG + Intronic
936130455 2:109835125-109835147 TTTTCTTTTTAAATTGTTTAGGG + Intronic
936214242 2:110536360-110536382 TTTTCTTTTTAAATTGTTTAGGG - Intronic
936423379 2:112390919-112390941 TTTTCTTTTTAAATTGTTTAGGG - Intronic
936688004 2:114850717-114850739 GTTCCTTTTTGAACTGGTTATGG - Intronic
938315476 2:130324007-130324029 ATTCATTATTAGCATGTTTAGGG + Intergenic
938918208 2:135965611-135965633 GTTCCTTTATAACTTGCTGAAGG + Intronic
939107607 2:137967563-137967585 GTTCCTTTTTACCCATTTTATGG + Intronic
939228282 2:139391347-139391369 GTTCCTTGTTCACCTGTTGAAGG + Intergenic
939233532 2:139462122-139462144 CATCCATTTTAACATATTTAAGG + Intergenic
939490190 2:142867632-142867654 GTCTCTTTTTAAAATGTTTCCGG - Intergenic
940470017 2:154084871-154084893 TTTCCTTCTTAACAAATTTAAGG - Intronic
940514770 2:154668713-154668735 GTTCTTTTCTATCATTTTTATGG - Intergenic
941171838 2:162147219-162147241 GATCATTTTGAAGATGTTTAGGG - Intronic
941867597 2:170350981-170351003 CTTCCTTCTTAATATGTTTTTGG - Intronic
942054540 2:172169989-172170011 GTTTTTTTTTAATATCTTTATGG - Intergenic
942814890 2:180041284-180041306 GTTTCTTTCAAAAATGTTTATGG + Intergenic
942848203 2:180451777-180451799 GTGACTTCTTAACATTTTTATGG - Intergenic
943198508 2:184787946-184787968 GTTTTATTTTAACATTTTTATGG + Intronic
943641879 2:190368472-190368494 TTTCCTTTTTAAAATGTTTGTGG + Intronic
944464398 2:199985629-199985651 GTTCATTTCTAACTTCTTTAGGG + Intronic
945535161 2:211007705-211007727 GTTTCTTTTTAATGTTTTTATGG - Intergenic
945577493 2:211549941-211549963 GTTCCACTTTATCATGTATAAGG - Intronic
945856880 2:215079760-215079782 GTTACTTAATAAAATGTTTAGGG + Intronic
948411303 2:237763474-237763496 ACTCTTTTTTAACATCTTTAAGG - Exonic
1168822583 20:785584-785606 TTTCTTTTTTATCATGTTGACGG + Intergenic
1170200595 20:13739617-13739639 GTTATTTTTATACATGTTTATGG + Intronic
1170653062 20:18260483-18260505 GTTCATATTTAACTTATTTAAGG - Intergenic
1173942545 20:46924158-46924180 GTTTATTTTTAACTTGTTTTAGG + Intronic
1175627775 20:60503221-60503243 GGTCATTTTAAACATGTTTAGGG + Intergenic
1178893400 21:36539142-36539164 ATTCATTTTAAAAATGTTTATGG + Intronic
1179813606 21:43888344-43888366 TTTACTTTTTAACATTTGTAAGG + Intronic
1180492161 22:15859943-15859965 GTTCCCATCTCACATGTTTAAGG + Intergenic
1184542105 22:45133050-45133072 CTTTCTTTTTAAAATGTATATGG - Intergenic
1184985172 22:48127380-48127402 ATTCTTTTTTACCATGTTTATGG + Intergenic
949207928 3:1462713-1462735 GTTCACTTAAAACATGTTTAGGG + Intergenic
949764391 3:7510181-7510203 GGTCCTCTTTTACATGTTTGTGG + Intronic
950083651 3:10241023-10241045 GTTCCTATTTATGATGTTGAGGG - Intronic
951310494 3:21119618-21119640 GTTTATTTTTAACATGTAAATGG - Intergenic
952310843 3:32188261-32188283 CTTCCTTTTTAAGATGATTGTGG + Intergenic
953001745 3:38940388-38940410 GTTCCTTTTGAGAATTTTTATGG - Intronic
953398844 3:42594271-42594293 CTTCTTGTTTAACATATTTAAGG - Intronic
954827791 3:53390421-53390443 TTTCCTTTTTAACCTGTGGAAGG - Intergenic
955961508 3:64345658-64345680 TTTCCTTTTTAATATGATTCTGG - Intronic
956070354 3:65443162-65443184 GTTCCTATCTTAAATGTTTACGG + Intronic
957418508 3:79937284-79937306 GTACCTTTTATAAATGTTTAAGG - Intergenic
958479372 3:94627140-94627162 GTACATTTTTTACATTTTTAGGG - Intergenic
959404603 3:105944844-105944866 GATGCTTTTTAACATGTTGAAGG + Intergenic
959751641 3:109843938-109843960 TTTTTTTTTAAACATGTTTAAGG - Intergenic
960429586 3:117552427-117552449 GTTCCTTAATAACATGTTTATGG - Intergenic
960816436 3:121678217-121678239 TTTCATATTTAACATCTTTATGG - Intronic
961217016 3:125167444-125167466 GTTCCTTGTTAAAATTTTTAAGG - Intronic
962393740 3:134996148-134996170 GTTCCTTATTTACATATTTTTGG + Intronic
963317549 3:143775727-143775749 CTTCATTCTTCACATGTTTAGGG + Intronic
963375704 3:144460881-144460903 TTTCTTTCTTAACATGTTTTGGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964660784 3:159118012-159118034 ATTACTTTTTACCATTTTTATGG - Intronic
965908625 3:173742613-173742635 TTTCCTTCATAACATGTTTTTGG + Intronic
966075208 3:175927375-175927397 GTTCCTTAGTAAATTGTTTAGGG - Intergenic
967628305 3:191711981-191712003 GCTACTTTTTAACAGCTTTATGG - Intergenic
967665846 3:192170989-192171011 GTTCCTTATTTACATGTTAAGGG - Intronic
967926903 3:194657361-194657383 GTTCCTTTTAAATATGTTAATGG - Intronic
968682932 4:1933970-1933992 GTTACTACTTAACATGTTTAAGG + Intronic
969160776 4:5256798-5256820 GTTCATTTTTAAGAAGTTCAGGG - Intronic
970326137 4:14927059-14927081 ATTCCTTAATCACATGTTTATGG - Intergenic
971647441 4:29227497-29227519 GTTCCTTTTTAAAAAAATTATGG + Intergenic
972115460 4:35627688-35627710 ATTCATTTTTAACCTGTTTCAGG + Intergenic
972172513 4:36364022-36364044 GTTTTTTTTTAAAATGTATAAGG - Intergenic
973236253 4:47909312-47909334 GTTACTTTTGTACCTGTTTATGG - Intronic
973706274 4:53583898-53583920 GTTCTATTTCATCATGTTTATGG - Intronic
975664431 4:76720960-76720982 TTTCCTTTTTAAAATGTGAAAGG + Intronic
975682477 4:76890315-76890337 GTTATTTTTTAAAATGTATAGGG + Intergenic
975955807 4:79836853-79836875 GTTATCTTTTAACATTTTTAAGG + Intergenic
977424733 4:96853326-96853348 GTAACCTTTTAACATGTATATGG - Intergenic
978109531 4:104945916-104945938 ATTCCTTTTTAACATATGAAAGG + Intergenic
978820859 4:112964067-112964089 TTTCCTTTTTAAAATTTTTAAGG + Intronic
979944563 4:126812702-126812724 GTTCCTTTTTGAAAAGTCTAGGG - Intergenic
981445749 4:144836689-144836711 GTTACTTTTTAACAGTTTTATGG - Intergenic
981854852 4:149276863-149276885 GTTTCTTCTTAAAAGGTTTAAGG - Intergenic
983176899 4:164599822-164599844 TTTCCTTTTTAATATATTTGAGG + Intergenic
984010803 4:174369320-174369342 TTTCCTTTTAAAAATGTTTTAGG - Intergenic
984614238 4:181877965-181877987 ATTCCTGCTAAACATGTTTAAGG + Intergenic
985141666 4:186846153-186846175 GCTAATTTTTAAAATGTTTATGG + Intergenic
985142079 4:186850938-186850960 GTTTCTTTTTAATTTCTTTATGG + Intergenic
986054551 5:4122969-4122991 ATTCCTGCTTAACATTTTTAAGG - Intergenic
987104212 5:14621329-14621351 CTTCTTTTTAAACGTGTTTAGGG - Intergenic
987170876 5:15256300-15256322 CTTCCTTTTAAAAATGATTAGGG - Intergenic
987434776 5:17881827-17881849 GTTCTTTTTTTACTTCTTTAAGG + Intergenic
987576484 5:19734803-19734825 GTTTCTTTTTGAAATATTTATGG + Intronic
988011034 5:25486044-25486066 GAGCTTTTTTAACATGTTTGTGG + Intergenic
989121665 5:38010428-38010450 GTTCATTTCTAAGATGATTAGGG - Intergenic
989599038 5:43184708-43184730 ATCCCTTTATAAAATGTTTAAGG + Intronic
990480150 5:56202555-56202577 GTTTCTTTCTAACATTTTAAAGG + Intronic
990710910 5:58579394-58579416 GATCTTTTTAAACATATTTAGGG + Intergenic
994377780 5:99034721-99034743 ATTCCAATTTAATATGTTTAGGG - Intergenic
994654290 5:102570500-102570522 TTTTCTTTTTAACTTCTTTATGG - Intergenic
995148500 5:108813962-108813984 GTTCATTTTTAACATGGAAATGG - Intronic
995484789 5:112629264-112629286 GTTTCTTTTTTAAATGTTTGGGG + Intergenic
995752098 5:115462805-115462827 GTTCCATTTTAAGATTTTTGAGG - Intergenic
996105962 5:119503676-119503698 GGTTATTTTTAACATGATTAGGG - Intronic
996424348 5:123296870-123296892 GTTTATTTTTAATATGTTTATGG + Intergenic
997191707 5:131943788-131943810 ATTCCTTTATAACATGTTTTTGG - Intronic
998853690 5:146374850-146374872 GTTCATTTTAAAAATATTTATGG - Intergenic
998863445 5:146469820-146469842 ATTTCTTTTTAACATATTTGAGG + Intronic
999624935 5:153510838-153510860 GTTCATTTTTAAAGTGTTTTAGG + Intronic
999961063 5:156756081-156756103 GTTCCTTTTTAACATGTTTAAGG + Intronic
1000126243 5:158246691-158246713 GGTCCTTCTCAACATGCTTATGG + Intergenic
1000578102 5:163001388-163001410 GTGCATTTTTAACAAGTTTCTGG + Intergenic
1000596785 5:163223885-163223907 GATCTTATTTAACAAGTTTAGGG + Intergenic
1000829762 5:166088134-166088156 CTTCCTTTTTAACCTGTTTTTGG - Intergenic
1202774213 5_GL000208v1_random:49413-49435 GTACCTTTTTAGCATATTGAGGG - Intergenic
1003144354 6:3497451-3497473 CTTCCTTTTTTATATATTTATGG - Intergenic
1003716607 6:8653223-8653245 GTTCATTTTTCAATTGTTTAGGG + Intergenic
1004569804 6:16834201-16834223 GTTTCTTTTTATTTTGTTTAAGG - Intergenic
1005173082 6:23010887-23010909 TTTCCTTTTTAATATATTAAAGG + Intergenic
1005726380 6:28652998-28653020 GTGCATTATTCACATGTTTATGG + Intergenic
1006907612 6:37543654-37543676 ATTACTTTTTAATTTGTTTACGG - Intergenic
1007144775 6:39617412-39617434 GTTCCTTTTCAGCAAGTTGATGG - Intronic
1008271233 6:49492890-49492912 GTTCCTTTTTAATACTTTTTGGG - Exonic
1008473347 6:51909229-51909251 GTTTCTTTCTCCCATGTTTAAGG - Intronic
1008949371 6:57138607-57138629 ATTCCTTTTTACCATATTTCTGG - Intronic
1009317879 6:62245221-62245243 GTTACTTTTCAACATATTTTTGG + Intronic
1009622989 6:66099828-66099850 GTACAGTTGTAACATGTTTAGGG + Intergenic
1009958159 6:70482430-70482452 TTTGCTTTCTAACATGTTTTTGG - Intronic
1010965445 6:82201041-82201063 TTTCCTTTTTGGCAGGTTTATGG - Intronic
1011565960 6:88671998-88672020 GTTATTTTTTAGAATGTTTATGG - Intronic
1011803519 6:91045731-91045753 CTTTCTTTTTAAAATGTTTTCGG + Intergenic
1012019466 6:93899253-93899275 ATTCCTTTTTATCATGTTATTGG - Intergenic
1012116564 6:95306106-95306128 CTTTCTTTTTAAAATGTTTGGGG + Intergenic
1012356788 6:98324033-98324055 GTTACATTTTAAAATGTTTAAGG - Intergenic
1012614216 6:101255598-101255620 CTTGCTTTTTAAAATGTTTAAGG - Intergenic
1013158378 6:107517010-107517032 GTTGTTTTTTAAAATGTATATGG + Intronic
1014144338 6:117980062-117980084 GTTTCTGTTTTATATGTTTATGG + Intronic
1015442651 6:133266752-133266774 TTTCCTTTTTCACATTTTTCAGG - Intronic
1015760513 6:136654849-136654871 GTTCCTATTTGGCATGTTCATGG + Intronic
1015768811 6:136747869-136747891 ATTCCTTTTTACCCTGTTTATGG - Intronic
1016107883 6:140185360-140185382 GTTTCTTTTTAAAATGGTTGTGG - Intergenic
1016189364 6:141243949-141243971 GTTCCCTTTTAATATTTTTGAGG + Intergenic
1016566150 6:145456913-145456935 TTTCCTTTATAACATCTGTAAGG - Intergenic
1016709986 6:147159267-147159289 GTTCATTTTTTAAGTGTTTATGG - Intergenic
1017037234 6:150277685-150277707 TTTCCTTTTTTAAATGATTATGG + Intergenic
1017347641 6:153403598-153403620 GTCCCTTTTTAACTTACTTAGGG - Intergenic
1017696066 6:157017633-157017655 ATTGCTTTTTAACCTTTTTAGGG + Intronic
1018247975 6:161840445-161840467 CTTTCTTTTTAACAAGTTCAGGG + Intronic
1018352784 6:162978860-162978882 ATTGATTTTTAACATTTTTAAGG + Intronic
1019854804 7:3594000-3594022 CATGATTTTTAACATGTTTAGGG + Intronic
1019902590 7:4034119-4034141 GTTTCTTTTTAACTTGATTCAGG - Intronic
1020725335 7:11806408-11806430 TTTCCTTTTTACCATCTTTTTGG - Intronic
1020821192 7:12970301-12970323 GTTGCTTTTTAAAATGCTTTGGG + Intergenic
1021096904 7:16545951-16545973 GTTACTTTTGAATATTTTTAAGG + Intronic
1024217626 7:47261223-47261245 TTTGCTTGTTAACTTGTTTAAGG - Intergenic
1024312751 7:47984626-47984648 TTTCCTTGTTAATATTTTTATGG + Intergenic
1024507116 7:50171324-50171346 GTTCCATTCTAGCATGTTTTTGG + Intergenic
1026703174 7:72666106-72666128 GTTCTTTTTTATTATTTTTATGG - Intronic
1027455289 7:78383704-78383726 GTTTCCTTTTAATATCTTTATGG + Intronic
1027744221 7:82053544-82053566 GTTACTTATTTACTTGTTTATGG - Intronic
1028067888 7:86411178-86411200 GTTCTGTTTTAACATTTTAAAGG - Intergenic
1028323189 7:89488005-89488027 TTTTCATTTTAACATTTTTAGGG - Intergenic
1028878855 7:95856502-95856524 GTTCATTTTCAAAATTTTTATGG + Intronic
1030821778 7:114101525-114101547 GATTATTTTTAACATGTCTATGG + Intronic
1031914632 7:127551688-127551710 GTTCTTTTTTAGAGTGTTTATGG - Intergenic
1032620785 7:133529210-133529232 TTGCCTTTTTATTATGTTTATGG + Intronic
1033688893 7:143719503-143719525 ATTTATTTTTATCATGTTTAAGG - Intronic
1033697770 7:143809810-143809832 ATTTATTTTTATCATGTTTAAGG - Intergenic
1036466918 8:9006686-9006708 GTTCCTTGTTAACAATGTTAAGG - Intronic
1037542170 8:19882678-19882700 GAACCTCTTTAACATTTTTAAGG - Intergenic
1038852558 8:31294291-31294313 GTACATTTTTTTCATGTTTAAGG + Intergenic
1038893899 8:31758931-31758953 TTACCTTTTTAATATGTTAAAGG + Intronic
1039336418 8:36595616-36595638 CTTTTTTTTTAACTTGTTTACGG + Intergenic
1039496417 8:37984180-37984202 GTTCCTTTTTAAGATTTATTTGG + Intergenic
1040776468 8:51049330-51049352 TTGCCTTTTAAACATTTTTAGGG - Intergenic
1041641291 8:60205158-60205180 TTTCTTTTTTAACGTATTTAGGG + Intronic
1042632519 8:70834595-70834617 TTTCCTTGTTAAAATGTTTTTGG + Intergenic
1042952793 8:74218875-74218897 GTTCCTTTTTACCTTGTTTATGG - Intergenic
1043277075 8:78411626-78411648 GTTCCTTTTTCACAGCTCTAAGG + Intergenic
1044169195 8:89027533-89027555 TTTCCTTTTTAAGATGTTCTGGG - Intergenic
1044217096 8:89624782-89624804 GTTACTTTTTCACATGTCTTTGG - Intergenic
1046332482 8:112737657-112737679 GTTCTTTTTTATCATTGTTAAGG - Intronic
1050673564 9:8025706-8025728 CTTTCTTTTTTAAATGTTTAAGG - Intergenic
1050810006 9:9732949-9732971 GTTCCTTTTGTTCATATTTATGG + Intronic
1050937576 9:11417609-11417631 GTTCTTTTTAAAAAAGTTTATGG + Intergenic
1052296514 9:26901704-26901726 GTGACTTTTTGAAATGTTTAGGG - Intergenic
1052470462 9:28888244-28888266 GATCCTTTATAATCTGTTTATGG - Intergenic
1052499356 9:29270151-29270173 GTTACTTTCTAAAATGTTTAAGG - Intergenic
1052723830 9:32205099-32205121 GTTTCTTTTTAAAATATTTATGG - Intergenic
1054758584 9:68983887-68983909 GTTTCTTTTTAAAATTTTTTTGG - Intronic
1055262001 9:74447887-74447909 ATTCATTTTTACCATGATTAGGG - Intergenic
1055542210 9:77322539-77322561 CTTTTTTTTTAACATTTTTATGG + Intronic
1056770023 9:89471333-89471355 GATCATTTTAACCATGTTTAAGG - Intronic
1058189951 9:101901333-101901355 GTTCTTTTTTGTCATCTTTAGGG + Intergenic
1058343531 9:103928178-103928200 GTACCTTTCTAACAAGTATATGG - Intergenic
1059397477 9:114047119-114047141 GTTACTCCTTGACATGTTTATGG - Intronic
1061460781 9:130736795-130736817 GAACGTTTTTAACATGTTTAGGG + Intronic
1061691216 9:132332941-132332963 GTTTTTTTTTAAGATGGTTAAGG + Intronic
1062676124 9:137745310-137745332 GTACATTTTTAGCATGTTTTAGG + Intronic
1203417978 Un_KI270366v1:175-197 GTACCTTTTTAGCATATTGAGGG - Intergenic
1186049681 X:5577531-5577553 CTTCCTTTGAAAAATGTTTATGG - Intergenic
1186321552 X:8432096-8432118 GAACCTTTTTCTCATGTTTATGG - Intergenic
1186385002 X:9101142-9101164 GTACCTTTTAATCATGTTAATGG - Intronic
1187399812 X:18949701-18949723 GTGCATTTTTTACATGTTTAAGG - Intronic
1187825025 X:23326339-23326361 TTTCCGTTTTAACATTTTGAGGG + Intergenic
1188392319 X:29636087-29636109 TTACCTCTTAAACATGTTTATGG - Intronic
1189441115 X:41037048-41037070 CTTGCTTTTTAAAATTTTTAGGG - Intergenic
1190423963 X:50314011-50314033 GTACATTTTTACCATGTTTTTGG - Intronic
1191920586 X:66252644-66252666 GTTCTTTTTTAACATTGTTTTGG - Intronic
1191939288 X:66460550-66460572 GTTACTGTTTTACATGATTATGG + Intergenic
1192333163 X:70196104-70196126 GTTCATTTTTACCAGTTTTATGG - Intronic
1193271354 X:79533037-79533059 GTTCTTTTTTTATATGTTTTAGG + Intergenic
1193634313 X:83929427-83929449 ATTCCTTTGTAAAATATTTATGG + Intergenic
1193842659 X:86426843-86426865 GTTCCTTATTAACATATTTCTGG - Intronic
1193986126 X:88242678-88242700 TTGCCTTTTTAACATGTATGTGG + Intergenic
1194065531 X:89256124-89256146 GTTACTCTATAACATGATTATGG + Intergenic
1195331226 X:103802639-103802661 GTTACTTTTTTACAACTTTATGG + Intergenic
1196194954 X:112829767-112829789 GTTGCCTATAAACATGTTTAAGG - Intronic
1197154479 X:123255500-123255522 TTTCGTTTTTAAAATGTTTCAGG - Intronic
1198327557 X:135588861-135588883 GTTCCCTTTTAAGAGTTTTATGG - Intergenic
1198477727 X:137011585-137011607 CTTCATATTTATCATGTTTATGG + Intergenic
1198706114 X:139450258-139450280 ATTCCTATTTAACATGATCATGG - Intergenic
1200719700 Y:6590254-6590276 GTTACTCTATAACATGATTATGG + Intergenic
1201938039 Y:19428489-19428511 TTTCCTTGTCACCATGTTTATGG - Intergenic