ID: 999966596

View in Genome Browser
Species Human (GRCh38)
Location 5:156816835-156816857
Sequence ATCTAGAAGCAAATCCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999966596_999966599 26 Left 999966596 5:156816835-156816857 CCAACTAGGATTTGCTTCTAGAT No data
Right 999966599 5:156816884-156816906 GATGGACATAGCTACCATAATGG No data
999966596_999966597 8 Left 999966596 5:156816835-156816857 CCAACTAGGATTTGCTTCTAGAT No data
Right 999966597 5:156816866-156816888 CTATGCCTTTAATCACAAGATGG No data
999966596_999966600 27 Left 999966596 5:156816835-156816857 CCAACTAGGATTTGCTTCTAGAT No data
Right 999966600 5:156816885-156816907 ATGGACATAGCTACCATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999966596 Original CRISPR ATCTAGAAGCAAATCCTAGT TGG (reversed) Intergenic
No off target data available for this crispr