ID: 999968823

View in Genome Browser
Species Human (GRCh38)
Location 5:156838378-156838400
Sequence CAGAGGAATCTGAAGGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999968819_999968823 2 Left 999968819 5:156838353-156838375 CCATACAAATGTAAGATGTTAAT No data
Right 999968823 5:156838378-156838400 CAGAGGAATCTGAAGGAAGGCGG No data
999968818_999968823 20 Left 999968818 5:156838335-156838357 CCAATTGTAAGAAATGTACCATA No data
Right 999968823 5:156838378-156838400 CAGAGGAATCTGAAGGAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999968823 Original CRISPR CAGAGGAATCTGAAGGAAGG CGG Intergenic
No off target data available for this crispr