ID: 999971629

View in Genome Browser
Species Human (GRCh38)
Location 5:156869520-156869542
Sequence TAAGATACATAACCTGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999971627_999971629 -2 Left 999971627 5:156869499-156869521 CCCATCTTGTGGGCAAAACACTA No data
Right 999971629 5:156869520-156869542 TAAGATACATAACCTGCTCTAGG No data
999971625_999971629 0 Left 999971625 5:156869497-156869519 CCCCCATCTTGTGGGCAAAACAC No data
Right 999971629 5:156869520-156869542 TAAGATACATAACCTGCTCTAGG No data
999971626_999971629 -1 Left 999971626 5:156869498-156869520 CCCCATCTTGTGGGCAAAACACT No data
Right 999971629 5:156869520-156869542 TAAGATACATAACCTGCTCTAGG No data
999971628_999971629 -3 Left 999971628 5:156869500-156869522 CCATCTTGTGGGCAAAACACTAA No data
Right 999971629 5:156869520-156869542 TAAGATACATAACCTGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999971629 Original CRISPR TAAGATACATAACCTGCTCT AGG Intergenic
No off target data available for this crispr