ID: 999972996

View in Genome Browser
Species Human (GRCh38)
Location 5:156883589-156883611
Sequence TGGTGTAAGGGGCAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999972996_999973007 28 Left 999972996 5:156883589-156883611 CCCTTCACCTGCCCCTTACACCA No data
Right 999973007 5:156883640-156883662 GTTCCTTTTCAGCCTGCAGATGG No data
999972996_999973005 6 Left 999972996 5:156883589-156883611 CCCTTCACCTGCCCCTTACACCA No data
Right 999973005 5:156883618-156883640 ACAAAGTTAATCACCAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999972996 Original CRISPR TGGTGTAAGGGGCAGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr