ID: 999973542

View in Genome Browser
Species Human (GRCh38)
Location 5:156888845-156888867
Sequence CTGAATACAGATATCAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999973539_999973542 -5 Left 999973539 5:156888827-156888849 CCTGGTAATTGATCCAGACTGAA No data
Right 999973542 5:156888845-156888867 CTGAATACAGATATCAGACAGGG No data
999973536_999973542 13 Left 999973536 5:156888809-156888831 CCCTTTACAAGCAAAACACCTGG No data
Right 999973542 5:156888845-156888867 CTGAATACAGATATCAGACAGGG No data
999973538_999973542 12 Left 999973538 5:156888810-156888832 CCTTTACAAGCAAAACACCTGGT No data
Right 999973542 5:156888845-156888867 CTGAATACAGATATCAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999973542 Original CRISPR CTGAATACAGATATCAGACA GGG Intergenic
No off target data available for this crispr