ID: 999973542 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:156888845-156888867 |
| Sequence | CTGAATACAGATATCAGACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 999973539_999973542 | -5 | Left | 999973539 | 5:156888827-156888849 | CCTGGTAATTGATCCAGACTGAA | No data | ||
| Right | 999973542 | 5:156888845-156888867 | CTGAATACAGATATCAGACAGGG | No data | ||||
| 999973536_999973542 | 13 | Left | 999973536 | 5:156888809-156888831 | CCCTTTACAAGCAAAACACCTGG | No data | ||
| Right | 999973542 | 5:156888845-156888867 | CTGAATACAGATATCAGACAGGG | No data | ||||
| 999973538_999973542 | 12 | Left | 999973538 | 5:156888810-156888832 | CCTTTACAAGCAAAACACCTGGT | No data | ||
| Right | 999973542 | 5:156888845-156888867 | CTGAATACAGATATCAGACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 999973542 | Original CRISPR | CTGAATACAGATATCAGACA GGG | Intergenic | ||
| No off target data available for this crispr | |||||