ID: 999973871

View in Genome Browser
Species Human (GRCh38)
Location 5:156891752-156891774
Sequence CATCATAGGGAGAATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999973871_999973877 -1 Left 999973871 5:156891752-156891774 CCAGCCTCATTCTCCCTATGATG No data
Right 999973877 5:156891774-156891796 GAGTTCACGAGGGATCTGTGAGG No data
999973871_999973878 11 Left 999973871 5:156891752-156891774 CCAGCCTCATTCTCCCTATGATG No data
Right 999973878 5:156891786-156891808 GATCTGTGAGGCCCTGCATCAGG No data
999973871_999973881 30 Left 999973871 5:156891752-156891774 CCAGCCTCATTCTCCCTATGATG No data
Right 999973881 5:156891805-156891827 CAGGTGAGTCCACCAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999973871 Original CRISPR CATCATAGGGAGAATGAGGC TGG (reversed) Intergenic
No off target data available for this crispr