ID: 999977322

View in Genome Browser
Species Human (GRCh38)
Location 5:156924580-156924602
Sequence TCTGACCTGCACAAACTCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999977322_999977325 0 Left 999977322 5:156924580-156924602 CCATCGAGTTTGTGCAGGTCAGA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 999977325 5:156924603-156924625 AAGGAGATATTATATGACCAGGG 0: 1
1: 0
2: 0
3: 24
4: 229
999977322_999977328 23 Left 999977322 5:156924580-156924602 CCATCGAGTTTGTGCAGGTCAGA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 999977328 5:156924626-156924648 TTTATGAGGATACATAGTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 75
999977322_999977326 9 Left 999977322 5:156924580-156924602 CCATCGAGTTTGTGCAGGTCAGA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 999977326 5:156924612-156924634 TTATATGACCAGGGTTTATGAGG 0: 1
1: 0
2: 0
3: 9
4: 137
999977322_999977324 -1 Left 999977322 5:156924580-156924602 CCATCGAGTTTGTGCAGGTCAGA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 999977324 5:156924602-156924624 AAAGGAGATATTATATGACCAGG 0: 1
1: 0
2: 1
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999977322 Original CRISPR TCTGACCTGCACAAACTCGA TGG (reversed) Intronic
917231860 1:172846128-172846150 TCTGACTTGCACAAATTGGGAGG + Intergenic
918446729 1:184624278-184624300 TCTGAGCTGCACACACACCAGGG + Exonic
920420303 1:205828618-205828640 TCTCACCTGCACAAACTGTGAGG - Exonic
920769073 1:208863485-208863507 TCTTATCTCCACAAACTCTAAGG - Intergenic
923086332 1:230705984-230706006 TCTGACCTGGACAAGGTGGAGGG - Exonic
923418215 1:233786117-233786139 TTTCAGCTGAACAAACTCGATGG + Intergenic
1064344678 10:14521241-14521263 TTTCACCTTCACAAACTCGGGGG + Exonic
1065620781 10:27578692-27578714 TGTGACCTGCAGAAACTCTGAGG + Intergenic
1067694054 10:48523034-48523056 TCTCACCTGGACAAGGTCGAAGG + Intronic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1073899209 10:108200163-108200185 TCAGACCTGCACTAAATTGAGGG - Intergenic
1077895862 11:6452775-6452797 CCTGAGCTGCTCAAACTGGAGGG - Intronic
1081918254 11:46748426-46748448 TTGGATCTGAACAAACTCGAAGG + Intronic
1083155374 11:60819671-60819693 TCTGACCTGAGCCAACTGGAGGG + Intergenic
1083233532 11:61338055-61338077 TCTGACCTGGACAGCCTCAAGGG + Exonic
1088777006 11:113095042-113095064 TCTTAACTGCAAGAACTCGAAGG - Intronic
1103965953 12:124639434-124639456 TCTGACCTGGGGAAACTCAATGG - Intergenic
1106431306 13:29683046-29683068 TCTGACCTGCCCATAATCGTGGG - Intergenic
1115163511 14:30422325-30422347 TCTGACCTGGTCAGACTCCAGGG + Intergenic
1123787302 15:23686711-23686733 TTTGACCAGCGCAAACTCCATGG + Exonic
1124906774 15:33876085-33876107 TCTGAAGTGCTCAAACTCAAAGG + Intronic
1126457555 15:48880546-48880568 TCTGAGGTCCACAAACTAGAAGG + Intronic
1127621722 15:60740563-60740585 TCTGGCATGCACACTCTCGAAGG - Intronic
1128526415 15:68415255-68415277 TCTGACCTGCACAAAGGCTGGGG - Intronic
1129493957 15:75958896-75958918 TATGCCCTTCACAAACTCAATGG + Intronic
1138778500 16:59754552-59754574 ACTGACCTGGGCAAACACGATGG + Intronic
1139011726 16:62643198-62643220 GCTGACCTGCAGAAACTTGAGGG + Intergenic
1140155984 16:72427216-72427238 ACAGACATGCACAAACTTGAAGG + Intergenic
1142239006 16:88936553-88936575 TCTGAGCTGCCCAGACCCGACGG + Intronic
1144224526 17:13131949-13131971 TCAGACCTGTGCAAACTGGATGG - Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1150955474 17:69854610-69854632 TCTGTCCTGGAAAAACTCAAAGG + Intergenic
1151060860 17:71092082-71092104 TCTTCCCTGCACAAAGTAGATGG + Intergenic
1152162923 17:78680434-78680456 TCTGACCTTCACAAAATACAAGG + Intronic
1158457628 18:57621961-57621983 TCCGAGCTGCACAAACGCGTGGG - Exonic
1161377866 19:3949465-3949487 TCTGCCCTCCACAGACTCCATGG - Intergenic
928326175 2:30321381-30321403 TCTGACCTCCACTACCTCCATGG + Intronic
931107110 2:59068437-59068459 TTGGAGCTGCACAAACTCCACGG - Intergenic
931735379 2:65189037-65189059 TCTGTACTACACAAACTCTAAGG - Intergenic
933462302 2:82603781-82603803 TTTGACCTACAGAAACTCAAAGG + Intergenic
946489971 2:220139025-220139047 TCTGACCTCTAAAAACTCGAGGG + Intergenic
947125171 2:226861226-226861248 TCTCTCCTGCACACACTCAAGGG - Intronic
1170724307 20:18912672-18912694 TTTGACCTGAACAATCTGGAAGG + Intergenic
1172683369 20:36734612-36734634 TATGAACTGGACAAACTCAAAGG + Intronic
1173988585 20:47282149-47282171 TCTGGCCTGCAAAAGCTCTAAGG - Exonic
1174116037 20:48226892-48226914 CCAGACCTGCACAATCTCCAAGG + Intergenic
1174819167 20:53712447-53712469 TCTTACCTGCACGAACTAGTGGG - Intergenic
949641790 3:6044138-6044160 TATGACCTGCAAAATCTCAAAGG - Intergenic
951419165 3:22463425-22463447 TCTGATCTGCACAAACACCCAGG + Intergenic
952876637 3:37950258-37950280 ACTGACCTGCACAGACACTAAGG + Intronic
954871108 3:53768107-53768129 GCTGACTTTCACAAACTCTAAGG + Intronic
955254849 3:57320620-57320642 TCACACCTGCAGAAACTGGAAGG + Intronic
955608118 3:60728446-60728468 TTTTACCTGCAAAAACTTGAAGG - Intronic
955867468 3:63400291-63400313 TCTGACCTGCAGAATCTCTGTGG - Intronic
960005293 3:112775426-112775448 TCTGACCTCCACACTCTAGAAGG + Intronic
965654109 3:170965469-170965491 TCTGAGCTGTACAAAGTTGATGG - Intergenic
965952556 3:174328316-174328338 TCAAAGCTGCACAAACTCCAAGG - Intergenic
966428231 3:179804029-179804051 CCAGACCTGCAAGAACTCGAGGG + Intronic
970294153 4:14610422-14610444 TCTGTAATGCACAACCTCGACGG + Intergenic
971529433 4:27666509-27666531 GCTGACCTGCACAAATTTCAGGG - Intergenic
984556755 4:181223360-181223382 TATGAACTGCACAAATTAGAAGG + Intergenic
985286072 4:188337219-188337241 GCTGAGCTGCAGAAACTTGAGGG - Intergenic
988111039 5:26820084-26820106 TCTGACCTTCATAATCTCTATGG - Intergenic
994764057 5:103894043-103894065 TGTAACCTTCACAAACTCTAAGG + Intergenic
994860871 5:105191974-105191996 GCTGAACTTCACAAAATCGAAGG - Intergenic
999977322 5:156924580-156924602 TCTGACCTGCACAAACTCGATGG - Intronic
1000795992 5:165665389-165665411 TCTGACTTGCATAATCTCAAAGG + Intergenic
1002640515 5:180628557-180628579 TCTGCCCTGCAGAATCTCCAGGG - Intronic
1006404267 6:33835005-33835027 ACTGACTTGCACAGACTCGGGGG - Intergenic
1009641703 6:66345758-66345780 TCTGACCTCTACAGACTAGAAGG - Intergenic
1010739961 6:79489825-79489847 TCTGTCCTGCTAAAACTCAAAGG - Intronic
1018899193 6:168042782-168042804 TCTGGCCTGCACGTCCTCGAGGG + Intronic
1020784141 7:12553561-12553583 TCTGCCCTACACAAACTTGGAGG + Intergenic
1023571153 7:41573343-41573365 TTAGACCTGCACAAAATCGGAGG + Intergenic
1029259806 7:99294134-99294156 TCTGACCTTCTCCAAGTCGATGG - Intergenic
1032698326 7:134356939-134356961 TCTGGACTGCACACACTCAACGG + Intergenic
1036117919 8:5980032-5980054 TTTGACCTACACATACTAGAAGG - Intergenic
1037663146 8:20944133-20944155 TCTGACGTGCACATACTCCTGGG + Intergenic
1041972649 8:63761046-63761068 CCTCACCTGCACATACTCTATGG - Intergenic
1045266026 8:100619305-100619327 TCTGAGCTGCACAAACTGTGAGG + Intronic
1049457644 8:142701506-142701528 TCCGACCAGCACAAACTCGGCGG - Intronic
1053022999 9:34708710-34708732 TCTGTCCTGCACTAACTCCAGGG - Intergenic
1059254889 9:112920701-112920723 TCTAACCTCCAAAAACTCAAAGG + Intergenic
1187882300 X:23858636-23858658 TCTTACCTGGGCAAACACGATGG + Exonic