ID: 999977525

View in Genome Browser
Species Human (GRCh38)
Location 5:156926670-156926692
Sequence CACACTGCATGGCCTATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999977525_999977527 -8 Left 999977525 5:156926670-156926692 CCTATTATAGGCCATGCAGTGTG 0: 1
1: 0
2: 2
3: 22
4: 367
Right 999977527 5:156926685-156926707 GCAGTGTGATAGCTATACCTTGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999977525 Original CRISPR CACACTGCATGGCCTATAAT AGG (reversed) Intronic
900876993 1:5349935-5349957 CAGACTTCATGGCCCATGATGGG - Intergenic
903049860 1:20592647-20592669 CACACTTCCTGGCCTATCACTGG + Intronic
903151027 1:21408987-21409009 CACAGTGCCTGGCCAATAAATGG - Intergenic
903823633 1:26124966-26124988 CACAGTGCCTTGCCCATAATAGG + Exonic
904802481 1:33103707-33103729 CACAGTGCCTGGCATATAGTAGG + Intronic
904971655 1:34423798-34423820 CACAGTACCTGGCCTATAATAGG + Intergenic
904983427 1:34525504-34525526 AACACTGCATGGCCTGTAGCAGG + Intergenic
906332242 1:44896164-44896186 CACAATGCCTGGCTCATAATGGG + Intronic
907706955 1:56840593-56840615 TAAAATGCATGGCCTATACTAGG + Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907888533 1:58616559-58616581 CAAACTGAATTGCCTTTAATTGG - Intergenic
907977471 1:59446062-59446084 CATAATGCCTGGCGTATAATAGG + Intronic
908274234 1:62453222-62453244 CACACTCCATGTACTTTAATGGG - Intergenic
908504096 1:64777468-64777490 CACAATGCATTGCATATAGTAGG + Intronic
908619839 1:65965709-65965731 CACAGTGCATAGCGTATTATTGG + Intronic
908754178 1:67452888-67452910 CACAGTGCCTGGCATATACTGGG - Intergenic
909563808 1:77033295-77033317 CACAGTGCATGGCATACAGTAGG - Intronic
909722456 1:78791678-78791700 CACACTGAATGGGCAAAAATTGG + Intergenic
909912888 1:81282074-81282096 CACAATGCCTGGCGCATAATTGG + Intergenic
909936855 1:81561318-81561340 AACAGTGCATGACCTATAATAGG + Intronic
910691625 1:89971366-89971388 CACAATGTTTGGCATATAATAGG - Intergenic
910919136 1:92325046-92325068 CACAGTACATGACATATAATTGG + Intronic
911278258 1:95891196-95891218 CACACTGCATGGTCCACAGTAGG + Intergenic
911874015 1:103135846-103135868 CACACCCCAGGGCCTGTAATGGG - Intergenic
912128072 1:106565136-106565158 CACATTCCATGGCATAGAATGGG + Intergenic
912531153 1:110323598-110323620 CACACTGCCAGGCACATAATTGG - Intergenic
913303428 1:117398064-117398086 GACACTACCTGGCATATAATAGG - Intronic
914781062 1:150785579-150785601 CACACTCATTGGCATATAATTGG - Intergenic
915182023 1:154070032-154070054 CACACACCAGGGCCTATCATGGG + Intronic
916062461 1:161109568-161109590 CACAGTGCCTGGCATATAGTAGG - Intronic
916604147 1:166324532-166324554 CACAGTGCTTGGCATATAGTAGG - Intergenic
917212678 1:172646148-172646170 CACAGTGCTTGGCATATAGTAGG + Intergenic
917867526 1:179211606-179211628 CACAATGCCTGGCCTAAATTTGG - Intronic
918587562 1:186205245-186205267 CACAGTGCCTGGCATATAGTAGG + Intergenic
918649404 1:186942158-186942180 CACACATCTTGGGCTATAATGGG + Intronic
919377590 1:196814224-196814246 CACACACCAGGGCCTATCATGGG - Intergenic
919387104 1:196936121-196936143 CACACACCAGGGCCTATCATGGG - Intronic
919648996 1:200126803-200126825 CACTCTGCCTGGCCTATGAAGGG + Intronic
919681080 1:200435443-200435465 CACACTGCCTCGCACATAATTGG - Intergenic
920267506 1:204735008-204735030 CTCAGTGCATGGCATATAGTAGG - Intergenic
920583529 1:207135779-207135801 AACACTGAATGGCCTATTAAAGG - Intronic
921143380 1:212327726-212327748 TACAATGCCTGGCATATAATAGG - Intronic
921411969 1:214845525-214845547 CACAGTGCCTGGCACATAATAGG + Intergenic
922455885 1:225773170-225773192 CACAATGACTGGCCTATAAAAGG + Intergenic
1065201051 10:23313490-23313512 CAGACTGCGTGGCATGTAATAGG - Intronic
1065361162 10:24890415-24890437 CACACTACATGGCCTAGCAAGGG + Intronic
1065856835 10:29838125-29838147 CACACGGCATGTCATATAAATGG + Intergenic
1066181180 10:32962162-32962184 CACACAGCATTGCCTCCAATGGG + Intronic
1069986505 10:72287936-72287958 CACAGTGCCTGGCATATAGTAGG - Intergenic
1070456950 10:76626820-76626842 CACACAGCCTGGCCCAAAATGGG - Intergenic
1070576599 10:77683849-77683871 CTCAGTGCCTGGCATATAATAGG - Intergenic
1071252859 10:83838637-83838659 CACCATGCCTGGCCTGTAATTGG - Intergenic
1071946684 10:90653877-90653899 AACAATGCATGGCACATAATAGG + Intergenic
1072234789 10:93444278-93444300 CACAGTGCCTGGCATATAGTAGG - Intronic
1072639969 10:97204500-97204522 CACACTGCCTGGCACAGAATTGG - Intronic
1074338994 10:112607507-112607529 CACAGTGCCTGGCCTAAAATGGG + Intronic
1074694746 10:116039807-116039829 CACACACGTTGGCCTATAATTGG - Intergenic
1076709989 10:132327763-132327785 CACCATGCTTGGCCTATAATAGG + Intronic
1077344777 11:2041592-2041614 CACAATGCATGGCCCATGGTGGG + Intergenic
1077890867 11:6417498-6417520 CACAGTGCCTGGCATATATTAGG + Intronic
1078675355 11:13407493-13407515 CACAGTGCTGGGCATATAATGGG + Intronic
1078851538 11:15168578-15168600 CACACTGCATGGCACAAAAGGGG - Intronic
1078920116 11:15822465-15822487 CACCATGCATGGCCCATAATTGG + Intergenic
1079029229 11:16973492-16973514 CACAGTGCATGGCTTTTAAAAGG - Intronic
1079154239 11:17929623-17929645 CACAGCGCCTGGCATATAATGGG - Intronic
1079584387 11:22107658-22107680 CACACTGCAAGTCCCATGATAGG - Intergenic
1080510461 11:32964575-32964597 CACCGTGCCTGGCCTATAGTAGG - Intronic
1080549361 11:33358311-33358333 CACAGTGCCTGGCATATAGTGGG + Intergenic
1080681769 11:34483413-34483435 CACACTGCCGGGCATATAGTAGG + Intronic
1080693016 11:34574857-34574879 CACACTTTATGCCCTAAAATTGG - Intergenic
1080799681 11:35598608-35598630 CACACTGCCTGGCTCTTAATAGG + Intergenic
1081718753 11:45270703-45270725 TACACTGCATCACCTCTAATGGG - Intronic
1081795197 11:45813909-45813931 CACAGTGCCTGGCATATAACAGG - Intergenic
1081977870 11:47247324-47247346 CACAGTCCTTGGCCTTTAATAGG + Intronic
1081996379 11:47367263-47367285 CACCATGCTTGGCCTACAATAGG - Intronic
1085043276 11:73339240-73339262 CACAGTGCTTGGCATCTAATAGG + Intronic
1085325318 11:75602022-75602044 CACAGTGCCTGGCACATAATAGG + Intronic
1085332598 11:75666676-75666698 CACACTGCCTGGCATATAGTAGG + Intronic
1085660645 11:78363375-78363397 CACACTGCCTGGTATATAGTAGG + Intronic
1086206877 11:84268852-84268874 AACAGTGCATGGCATAAAATTGG + Intronic
1086430127 11:86728926-86728948 CACAATGCCTGGCACATAATAGG + Intergenic
1086900362 11:92360759-92360781 CACAGTGCCTGGCACATAATAGG - Intronic
1087448057 11:98280331-98280353 CAAAGTGCATGGCATATTATAGG + Intergenic
1088906450 11:114158814-114158836 CACACTGCCTGGCACATTATTGG + Intronic
1089108261 11:116033468-116033490 CACAGTGCCTGCCATATAATGGG + Intergenic
1089416889 11:118299651-118299673 GACACTGCTTAGCTTATAATGGG - Intergenic
1089992349 11:122873434-122873456 CACTGTGCCTGGCATATAATGGG + Intergenic
1090496582 11:127218643-127218665 CACAGTGCATGGCAAATAGTAGG - Intergenic
1090704321 11:129322752-129322774 CACAATGCCTGGCCTCTGATAGG + Intergenic
1091002947 11:131925925-131925947 CACAGTGCCTGGCACATAATAGG + Intronic
1202827763 11_KI270721v1_random:96782-96804 CACAATGCATGGCCCATGGTGGG + Intergenic
1092095139 12:5835894-5835916 TGCACTGAATGGCCTATAAGAGG - Intronic
1093292739 12:17348402-17348424 CAAATTGCATGGGATATAATGGG - Intergenic
1094192552 12:27711914-27711936 AACACTGCATGGTATACAATAGG - Intronic
1095727651 12:45470721-45470743 CACAGTGCCTGGAATATAATAGG - Intergenic
1095803124 12:46289473-46289495 CACACAGCATGACCTGTAGTAGG + Intergenic
1096940213 12:55336160-55336182 CACCCTGCCTTGCATATAATGGG - Intergenic
1097066063 12:56321516-56321538 CACTGTGCCTGGCCTATACTAGG + Intronic
1098074410 12:66713323-66713345 CACACTACCTGGCACATAATAGG - Intronic
1098089850 12:66889834-66889856 TACAATGCATGGCATATATTAGG - Intergenic
1099084988 12:78234927-78234949 AATACTGCTTGGCCTATAGTAGG - Intergenic
1099385945 12:82013424-82013446 CTGACTGCTTGGCCTAAAATTGG - Intergenic
1099967001 12:89458309-89458331 CACAGTGCTTGGCTTATAGTAGG - Intronic
1100086884 12:90921978-90922000 CACAATGCCTGGCTGATAATAGG + Intronic
1100392852 12:94159100-94159122 CACATTGCTTGGCACATAATAGG - Intronic
1100504113 12:95203108-95203130 GACACTGCAAGTCCTATTATGGG - Intronic
1100762526 12:97824922-97824944 CCCAGTGCATGGCCCATAGTGGG - Intergenic
1101066134 12:101023122-101023144 CACAGTGCCTGGCATATAGTAGG + Intronic
1101323526 12:103694684-103694706 CCCACTGCCTGGCCTGTAGTAGG + Intronic
1102895839 12:116597967-116597989 CACACTGCCTGGTACATAATAGG - Intergenic
1103314565 12:120042184-120042206 AACACTGCCTGGCATATAATAGG - Intronic
1104165723 12:126227686-126227708 CACACTGCATAGCTTAAACTGGG - Intergenic
1105910309 13:24858333-24858355 CACACTGCCTGGCAGATAACAGG - Intronic
1106705628 13:32276123-32276145 CACACTGCTTGGAGTATTATTGG + Intronic
1106744398 13:32684603-32684625 CATACTGCATGGAATATATTAGG + Intronic
1107690033 13:42944500-42944522 CACACACCAGGGCCTGTAATGGG + Intronic
1110798779 13:79670724-79670746 CACAGTGCCTGGCATATAGTAGG + Intergenic
1111692571 13:91582722-91582744 CACCGTGCCTGGCCTATAAATGG - Intronic
1112244658 13:97720763-97720785 CACAGTGCCTGGCATATACTAGG - Intergenic
1112635608 13:101214276-101214298 CACACTCCAGGGCCTGTCATGGG + Intronic
1113383414 13:109825170-109825192 CATACTGAATGGGCAATAATTGG - Intergenic
1115347814 14:32362042-32362064 CACAGTGCTTGGCCTATTGTAGG + Intronic
1115654155 14:35427188-35427210 AACAATGCATGGCCAATAGTAGG - Intergenic
1115714934 14:36093066-36093088 CACCGTGCCTGGCCTCTAATAGG + Intergenic
1117746422 14:58874274-58874296 CACAGTGTCTGGCATATAATGGG + Intergenic
1119416488 14:74473717-74473739 CACAGTGCCTGGCACATAATAGG + Intergenic
1119719600 14:76882198-76882220 CACAGTGCCTGGCACATAATAGG - Intergenic
1120707997 14:87764306-87764328 AACAATGCATGGCATATAGTAGG + Intergenic
1120977098 14:90258281-90258303 GACACTGCCTGGCATATAGTAGG + Intronic
1121171655 14:91859530-91859552 CACAGTGCCTGGCCCATAGTAGG - Intronic
1121179928 14:91921374-91921396 CCCACTGCCTGGCCCATAGTTGG - Intronic
1121758747 14:96425202-96425224 CACAGTGCCTGGGCCATAATCGG - Intronic
1121976185 14:98406055-98406077 CACTTTGCCTGGCATATAATGGG - Intergenic
1123094210 14:105758247-105758269 CACACTCCAGGGCATGTAATGGG - Intergenic
1202829976 14_GL000009v2_random:17482-17504 CACACACCATGGCCTGTCATGGG - Intergenic
1125010188 15:34863629-34863651 TTCAATGCCTGGCCTATAATAGG + Intronic
1125100404 15:35905928-35905950 CAGACTGCCTGGCATATAGTGGG + Intergenic
1125306305 15:38319741-38319763 TTCACTGCATTGCCTATAAACGG + Intronic
1126609187 15:50511706-50511728 CACAGTGCCTGGCCTATTCTGGG - Exonic
1126976750 15:54191210-54191232 CACACACCAGGGCCTATCATGGG - Intronic
1127551435 15:60042903-60042925 CCCACTGCCTTGCCCATAATTGG - Intronic
1128479747 15:68027096-68027118 CACATTGCCTGGCCCATAGTAGG - Intergenic
1128898482 15:71397521-71397543 CACAGTGCCTGGCCTACAATAGG + Intronic
1129089013 15:73129122-73129144 CACAGTGCTTGGCCCATAACTGG + Intronic
1131137322 15:89947804-89947826 CACAATGCATGGCCTATAGTAGG - Intergenic
1131428573 15:92367880-92367902 CATCCTGCCTGGCCTATGATTGG - Intergenic
1132019707 15:98349961-98349983 CACACTGCCTGGCACATAGTAGG - Intergenic
1133244227 16:4436874-4436896 CACCCAGCATGGCTTAGAATAGG - Intronic
1134182796 16:12061301-12061323 CACAGTGCCTGGCATATAATAGG + Intronic
1134915191 16:18063369-18063391 CCCAGTGCATGGCACATAATAGG + Intergenic
1135254668 16:20931578-20931600 CACAAAGCATGGCATATAGTAGG + Intergenic
1135743369 16:24995668-24995690 CACACCTGATGGCCTAGAATTGG - Intronic
1138341244 16:56290369-56290391 CACAGTGCCTGGCCCAGAATTGG + Intronic
1139415640 16:66806699-66806721 CACCATGCCTGGCCAATAATAGG + Intronic
1139793992 16:69467268-69467290 CACATTGCATGGCACATAGTAGG - Intergenic
1140732554 16:77869942-77869964 CACAATGCCTGGCACATAATAGG + Intronic
1143398106 17:6618938-6618960 CACAGCGCCTGGCCTATTATTGG - Intronic
1143709552 17:8724960-8724982 CGCACTCCATGGCCTACACTGGG + Intergenic
1143709669 17:8725632-8725654 CGCACTCCATGGCCTACACTGGG + Intergenic
1144253774 17:13445253-13445275 CACAGTGCTTGGACTATGATAGG + Intergenic
1145761402 17:27427182-27427204 CACACAGCAGGGCCTGTCATGGG - Intergenic
1146435365 17:32841176-32841198 CACTGTGCCTGGCCTACAATGGG - Intronic
1146475738 17:33161244-33161266 CACACTGCCTGGCATACAGTAGG - Intronic
1148062127 17:44844109-44844131 CACACTGCTTGGCCCATAGAAGG + Intergenic
1148704944 17:49621784-49621806 CACAGTGCCTGGCACATAATAGG - Intronic
1148995036 17:51702150-51702172 CACAATGCCTGGCACATAATAGG - Intronic
1149428076 17:56574455-56574477 AACAGTGCCTGGCCTATATTAGG + Intergenic
1151177425 17:72300329-72300351 CACTCTGCCTGGCCCAAAATGGG - Intergenic
1151432975 17:74077168-74077190 CACAGTGCCTGGCCTATAACAGG + Intergenic
1152257344 17:79247940-79247962 CACAGTGCCTGGCCCACAATGGG + Intronic
1152257354 17:79247984-79248006 CACAGTGCCTGGCCCACAATGGG + Intronic
1153609871 18:6873070-6873092 CACACACCATGGCCCTTAATTGG - Intronic
1154142691 18:11839131-11839153 AACAATGCCTGGCATATAATAGG + Intronic
1155389687 18:25321419-25321441 CACAATACCTGGCCTATAGTAGG - Intronic
1156252451 18:35364195-35364217 CACAGTACGTGGCCCATAATAGG - Intergenic
1156944509 18:42813317-42813339 CAAAATACATGGCCTATTATTGG - Intronic
1157123880 18:44937085-44937107 CACAGTGCTTGGCCCATAGTAGG - Intronic
1157521718 18:48349906-48349928 CACAGTGCCTGGCCTGTAATGGG + Intronic
1157607231 18:48933458-48933480 CACACAGCCTGGCACATAATAGG + Intronic
1158489643 18:57898456-57898478 CTCACTGCCTGGCATATAGTAGG + Intergenic
1159037179 18:63288942-63288964 CACAGTGCCTGGCACATAATAGG + Intronic
1159125630 18:64220764-64220786 CACACTGCCTGGCACATAGTAGG - Intergenic
1159942042 18:74415669-74415691 CACAGTGCCTGGCATATAGTTGG - Intergenic
1161867359 19:6842999-6843021 CACAGTGCCTGGCACATAATAGG + Intronic
1165161651 19:33820227-33820249 CACACTGCACGGAGCATAATTGG + Intergenic
1166895972 19:46022150-46022172 CACACTGCCTGGCACATAGTAGG + Intronic
1167338845 19:48903306-48903328 CACAGTGCCTGGCATATGATAGG + Intronic
1202642710 1_KI270706v1_random:110303-110325 CACACACCATGGCCTGTCATGGG + Intergenic
925230527 2:2229676-2229698 CACAGTGCCTTGCCTATAGTGGG - Intronic
926296531 2:11572984-11573006 CACAGTGCCTGGCCCATGATAGG + Intronic
927221582 2:20715423-20715445 CACACTGAATGGGCAAAAATTGG + Intronic
928871903 2:35990192-35990214 CACAGTGCAAGCCCTTTAATAGG + Intergenic
929041379 2:37747972-37747994 CACAGTGCCTGGCATATAAGAGG - Intergenic
929155085 2:38781886-38781908 CACACTTCCTGGCCTCTCATTGG - Exonic
929884840 2:45869474-45869496 CACAGTGCCTGGCGTGTAATAGG - Intronic
929890213 2:45912495-45912517 CACACTGCAGGGCCTTGATTGGG + Intronic
930418473 2:51119605-51119627 CACACTGCATGGCACATATGAGG + Intergenic
931094062 2:58919766-58919788 CACAGTGCCTGGCACATAATAGG + Intergenic
931813213 2:65875035-65875057 CACACTGCCTGGCATATAGTAGG - Intergenic
932319407 2:70810328-70810350 CACTGTGCCTGGCCTAAAATGGG - Intronic
932741799 2:74296472-74296494 CACAGTGCCTGGCCGACAATTGG - Intronic
934094194 2:88584146-88584168 CACAGTGCTTGGCACATAATTGG - Intronic
935113491 2:100113224-100113246 CTCACTGCTTGGCATGTAATAGG - Intronic
937033268 2:118758912-118758934 CACGGTGCATGGCACATAATTGG - Intergenic
939554123 2:143653814-143653836 CACAGTACCTGGCATATAATAGG + Intronic
940348430 2:152652635-152652657 GACAGTGCCTGGCATATAATAGG - Exonic
940541974 2:155031735-155031757 CACAGTGCCTGGCATACAATAGG + Intergenic
940996359 2:160154414-160154436 CACACAGCAGGGCCTGTTATGGG + Intronic
941469096 2:165862322-165862344 CACAGTGCCTGGCATAGAATAGG + Intronic
942079713 2:172388504-172388526 CACACTTTATCGACTATAATGGG + Intergenic
944196498 2:197060329-197060351 CACAGTGCCTGGCATATGATAGG - Intronic
944214238 2:197238247-197238269 CACAATGGCTGGCCTATAGTAGG + Intronic
944580887 2:201131814-201131836 CAGCCTGCCTGGCCCATAATTGG - Intronic
945715575 2:213354045-213354067 CACACACCAGGGCCTATCATGGG - Intronic
946269973 2:218583422-218583444 CATAGTGCATGGCATATAAGAGG + Intronic
946925497 2:224622817-224622839 CACACAGCAGGGCCTGTCATGGG + Intergenic
948162988 2:235840464-235840486 CACAGTGCATGGCTTCTAAAGGG - Intronic
948236729 2:236396819-236396841 AGCAGTGCCTGGCCTATAATCGG - Intronic
948545626 2:238726699-238726721 CACTATGCCTGGCCTAGAATGGG + Intergenic
1169817716 20:9675405-9675427 CACACAGCATGGCATACAGTAGG + Intronic
1170730887 20:18973868-18973890 CACAGTGCAGGGCCTAAAAAGGG - Intergenic
1170965099 20:21061294-21061316 CACTGTGCTTGGCCTACAATTGG - Intergenic
1172277654 20:33688720-33688742 CACAGTGCTTGGTATATAATAGG - Intergenic
1172891312 20:38267707-38267729 CACAGTGCTTGGCATATAACAGG + Intronic
1173509907 20:43619133-43619155 CTCAGTGCCTGGCATATAATGGG - Intronic
1174410790 20:50333780-50333802 CACAGTGCCTGGCATATAGTTGG - Intergenic
1174430741 20:50466811-50466833 AACACTGCCTGGCACATAATAGG + Intergenic
1174616981 20:51843252-51843274 CACAGGGCCTGGCATATAATAGG - Intergenic
1174711959 20:52716057-52716079 CACAATGCATGGCACATTATAGG - Intergenic
1175496510 20:59418239-59418261 CACAGTGCTTGGCATATAGTGGG - Intergenic
1176609162 21:8862322-8862344 CACACACCATGGCCTGTCATGGG - Intergenic
1177729942 21:25015751-25015773 CACCCTGCTTGGCCTGTAGTGGG - Intergenic
1178077971 21:29030206-29030228 CACAGTGCCTGCCCTATAGTAGG + Intronic
1178693056 21:34765862-34765884 CTCACTGCATGGAATGTAATAGG + Intergenic
1179722262 21:43322503-43322525 CGCACTGCATGGCCTCTGCTTGG - Intergenic
1182043981 22:27260049-27260071 CCCACTGCCTGGCATATAGTAGG - Intergenic
1182951862 22:34383559-34383581 GACACTGCATGGCATATACCAGG + Intergenic
1185225076 22:49647637-49647659 CACACTGCAGGCCCTATAGAAGG + Intronic
949454228 3:4221649-4221671 CACAGTGCCTGGCACATAATTGG - Intronic
949947452 3:9201847-9201869 CACATTGCCTGGCCCATAGTAGG - Intronic
950151871 3:10693781-10693803 CACACTGCCTGGCACATAGTAGG + Intronic
950532929 3:13563471-13563493 CACACTGCATGGCTTCTCGTGGG + Intronic
950847407 3:16028221-16028243 AATAGTGCATGGCATATAATAGG + Intergenic
952542517 3:34381341-34381363 CAGAATGCTTGGCCCATAATAGG + Intergenic
955402291 3:58601053-58601075 CACAGTGCCTGGCACATAATTGG + Intronic
955874898 3:63478520-63478542 CACAATGCTTGGCCCATAGTAGG + Intronic
956728500 3:72176469-72176491 CACACTGCTTGGCCCATGGTAGG + Intergenic
956846426 3:73187757-73187779 CACACTGGATGGCCAAGAAGAGG - Intergenic
957997563 3:87709670-87709692 CACACAGCAGGGCCTGTCATGGG + Intergenic
958480253 3:94636597-94636619 CACACACCAGGGCCTATCATAGG + Intergenic
958889623 3:99769228-99769250 CACACTGCCTGGCATATGAAGGG + Intronic
960304807 3:116048061-116048083 CACAGTGCTTGGCATATGATAGG + Intronic
962443232 3:135442531-135442553 CACATTGCATATCCTAAAATTGG - Intergenic
963057818 3:141201754-141201776 CACAGTGCCTGGCACATAATAGG + Intergenic
963152134 3:142056260-142056282 CACTGTGCTTGACCTATAATAGG - Intronic
963807954 3:149745374-149745396 CACAATACCTGGCATATAATAGG - Intronic
964045730 3:152323939-152323961 CAAACTGCATGTCATATAAAAGG - Intronic
966136262 3:176701793-176701815 AACAGTGCTTGGCATATAATTGG - Intergenic
966244835 3:177795817-177795839 CAAACCACATTGCCTATAATTGG + Intergenic
966406036 3:179599394-179599416 CACATTGTCTGGCATATAATAGG - Intronic
966933051 3:184688032-184688054 CCCAGTGCCTGGCCTATAGTAGG - Intergenic
967010213 3:185425990-185426012 CACACTGCATACCATGTAATAGG + Intronic
967032577 3:185621674-185621696 CACCATGCATGGCCCATAAATGG + Intronic
967137262 3:186522886-186522908 CACAGTGCTTGGCATATCATAGG + Intergenic
969146615 4:5129911-5129933 AACAGTGCCTGGCATATAATAGG - Intronic
969242325 4:5908108-5908130 CACAGTGCCTGGCATATAGTAGG - Intronic
970720453 4:18982451-18982473 CAAACTGTCTGGCATATAATGGG - Intergenic
971007744 4:22393852-22393874 CACAATTCATGGGATATAATAGG + Intronic
971288064 4:25309187-25309209 CACACTACATGGGCTAAAATCGG + Intergenic
971816645 4:31499248-31499270 CACACTCCATGGCCTGTCAGTGG - Intergenic
973582593 4:52358896-52358918 CACAGTACATGGCCTGTAAGAGG + Intergenic
974012212 4:56617471-56617493 CCCAATGCATGCCCTATAAGGGG - Intergenic
974342184 4:60628452-60628474 CACACTGAATGGGCTAAAGTTGG - Intergenic
975314552 4:72936418-72936440 CCCAGTGCTTGGCCTATCATAGG - Intergenic
975777331 4:77801735-77801757 CAAGGTGCATGGCTTATAATGGG - Intronic
975873818 4:78812255-78812277 CACTGTGCCTGGCCTTTAATGGG + Intronic
976373398 4:84316250-84316272 CACACTACATAGCACATAATAGG + Intergenic
976409152 4:84693085-84693107 CACAATGCCTGGCATATAAAAGG - Intronic
978294874 4:107193312-107193334 CAAAATGCATGGCCAATAAGAGG + Intronic
978827802 4:113045948-113045970 TGCAGTGCATGGCATATAATAGG - Intronic
982751233 4:159164599-159164621 CACAGTGTCTGGCATATAATAGG + Intronic
983430961 4:167650743-167650765 CACCATGCCCGGCCTATAATTGG - Intergenic
984234005 4:177134135-177134157 CACACACCATGGCCTGTCATGGG + Intergenic
989108323 5:37884328-37884350 TACAGTGCCTGGCATATAATAGG - Intergenic
989678040 5:43995815-43995837 CACAGTGCTTGGCCCATAGTGGG + Intergenic
990135060 5:52635035-52635057 AACAGTGCCTGGCCCATAATAGG + Intergenic
991385417 5:66083501-66083523 CACACAGCTTGGCATATAAAAGG - Intergenic
992502304 5:77355021-77355043 CACACTGCCTGGCATGTAGTAGG + Intronic
992844100 5:80727669-80727691 CCCAATGCCTGGCATATAATAGG - Intronic
992996699 5:82340872-82340894 TACAGTGCCTGGCCTACAATTGG + Intronic
995441813 5:112200574-112200596 CACACTGCATGGCATACAACAGG + Intronic
996918518 5:128738476-128738498 CACAGTGCTTGGCATATAGTAGG + Intronic
997905326 5:137811011-137811033 CACCATGCCTGGCCTAGAATCGG - Intergenic
998783720 5:145686290-145686312 CACAGTGCCTGGCTTATAAGGGG + Intronic
999929439 5:156414701-156414723 CACTCTGCATAGTTTATAATGGG - Intronic
999977525 5:156926670-156926692 CACACTGCATGGCCTATAATAGG - Intronic
1000105798 5:158057723-158057745 AACACTGCATGGCCTATGCCAGG - Intergenic
1000125743 5:158242053-158242075 CATACTGCATGGCACATAGTAGG + Intergenic
1000138793 5:158381244-158381266 CACAGTGCCTGGCACATAATAGG + Intergenic
1000250858 5:159493934-159493956 AACAGTGCCTGGCATATAATAGG - Intergenic
1000673450 5:164091015-164091037 CACAGTGCCTGGCACATAATAGG + Intergenic
1001016654 5:168147846-168147868 CACATTGCAGGGCCTCTAAAAGG + Intronic
1001825298 5:174740110-174740132 AGCACTGCATGGCCCATAGTAGG + Intergenic
1001919321 5:175587973-175587995 CACACAGCATGGCATATAATTGG + Intergenic
1004229314 6:13816925-13816947 CACAGTGCCTGGCCTATGATAGG + Intergenic
1005084581 6:21991942-21991964 CACAGTGCCTGGCATGTAATTGG + Intergenic
1006339929 6:33441329-33441351 CACACTGCATGCCCTACTCTGGG + Exonic
1006443540 6:34066581-34066603 AACACTGCCTGGCCCATAGTAGG + Intronic
1006605493 6:35253795-35253817 CTCACTACCTGGCATATAATAGG - Intergenic
1007355453 6:41312097-41312119 CTCACTGCATGGGCTAAGATGGG - Intergenic
1008077298 6:47158689-47158711 CACAGTGCCTGGCACATAATAGG - Intergenic
1008395440 6:51001190-51001212 CACACTGCATTGCAAATATTTGG + Intergenic
1012547517 6:100436314-100436336 CACAGTGCTTGGCACATAATAGG + Intronic
1014180292 6:118377031-118377053 AACAGTGCCTGGCATATAATAGG - Intergenic
1015449611 6:133350196-133350218 AACACTGCATGGCACATAATGGG - Intronic
1016827007 6:148397713-148397735 AACAGTGCATGGCACATAATAGG + Intronic
1017751129 6:157491400-157491422 CACACTGCTTTGCGTATAGTGGG + Intronic
1020414798 7:7933911-7933933 GACACTGCCTGGCATATGATAGG - Intronic
1021743621 7:23714821-23714843 CAAACTGTATGGCCTAAAAATGG - Intronic
1022110726 7:27229541-27229563 CACAGTGTCTGGCCTACAATGGG - Intergenic
1022992072 7:35718553-35718575 CACACAGCCTGGCATATGATAGG - Intergenic
1024359880 7:48456819-48456841 TATACAGCATTGCCTATAATAGG - Intronic
1027225609 7:76241826-76241848 CACAGTGCCTGGCATATAGTAGG - Intronic
1027986594 7:85299358-85299380 CACAGTTCATGGCATATAGTAGG - Intergenic
1029912983 7:104174616-104174638 CACACTGTATCGCTAATAATTGG + Intronic
1030333419 7:108297574-108297596 AACACTGCCTGGCATGTAATAGG - Intronic
1030732647 7:113008257-113008279 CACACTGAATGGGCAAAAATTGG - Intergenic
1030860247 7:114616449-114616471 CACCATGCCTGGCCTACAATAGG + Intronic
1031710785 7:125044093-125044115 CACAGTGCATGACATATGATAGG + Intergenic
1032293732 7:130615380-130615402 CTCAGTGCCTGGCATATAATAGG + Intronic
1033870022 7:145741669-145741691 AACAGTGCCCGGCCTATAATAGG - Intergenic
1034748516 7:153545556-153545578 CACATTTCATTGCCTATAATGGG + Intergenic
1036145235 8:6248797-6248819 CACACTGCCTGGTATATAAAGGG + Intergenic
1036630703 8:10512587-10512609 CACAGTGCCTGGTCTACAATAGG - Intergenic
1037102791 8:15067747-15067769 CACAGTGCATGGCATAGAATAGG - Intronic
1037464892 8:19150192-19150214 CACACTGGATTGCATATACTAGG + Intergenic
1037737258 8:21577697-21577719 CACAGTGCATGGCCCATGCTAGG - Intergenic
1038066152 8:23965754-23965776 CACACTGCCTGGCATGTAGTGGG - Intergenic
1038489042 8:27956466-27956488 CACAATGCCTGGCTTATACTAGG - Intronic
1038766838 8:30436687-30436709 CACACTGCATACCCTAGACTTGG - Intronic
1038979191 8:32738059-32738081 CACAATGCCTGGCTCATAATAGG - Intronic
1039889458 8:41674244-41674266 CACAGTGCCTGGCATGTAATCGG - Intronic
1041481458 8:58324455-58324477 AATAATGCATGGCATATAATCGG + Intergenic
1041939945 8:63375829-63375851 CACTGTGCCTGGCCTATTATAGG - Intergenic
1045082029 8:98636418-98636440 CACAATGCCTGGCATATGATAGG - Intronic
1046912830 8:119647382-119647404 CACCCTGCCTGGAATATAATAGG + Intronic
1047811575 8:128415655-128415677 AACAGTGCTTGGCATATAATAGG + Intergenic
1047911864 8:129539008-129539030 CACACTGCCTGGCACATAGTAGG + Intergenic
1048069267 8:131004661-131004683 CACACTGCTTGACCTATAGGAGG - Intronic
1048516660 8:135117375-135117397 TACACTGCATGGCCCCAAATGGG - Intergenic
1048962299 8:139590677-139590699 CACCCTGCCCGGCCTATAATTGG - Intergenic
1052319148 9:27149156-27149178 CACAATGCCTGGTTTATAATAGG - Intronic
1052333895 9:27300135-27300157 CACACTGTGTGGCCCATAACAGG + Intergenic
1053143141 9:35693913-35693935 CACTGTGCCTGGCCGATAATTGG + Intergenic
1053340366 9:37321415-37321437 CACTGTTCCTGGCCTATAATTGG + Intronic
1055161772 9:73138346-73138368 CACAGTGCCTGGCTCATAATAGG - Intergenic
1056166492 9:83946016-83946038 CACCATGCCTGGCCTATACTTGG - Intronic
1056623396 9:88234219-88234241 CACACTGCTGGGCCCATAACAGG - Intergenic
1058090060 9:100795715-100795737 AACAGTGCCTAGCCTATAATTGG + Intergenic
1058145421 9:101405785-101405807 CACCGTGCCTGGCCTAAAATGGG - Intronic
1059600558 9:115772932-115772954 CACAATGCATGGTCTTTAGTAGG - Intergenic
1059997580 9:119927285-119927307 CACAGTGCCTGGCATAAAATAGG + Intergenic
1060290533 9:122298672-122298694 CACTATGCTTGGCATATAATAGG - Intronic
1060370681 9:123067696-123067718 CACAGTGCTTGGTCTATAGTAGG + Intronic
1185844235 X:3422429-3422451 CACAGTGCCTGGCCTATAGGCGG - Intergenic
1187238741 X:17493529-17493551 CACAGTGCCTGGCATATAGTAGG + Intronic
1187902805 X:24040297-24040319 CACTCCGCCTGGCCTAAAATTGG + Intergenic
1187917997 X:24173882-24173904 CACCATGCCTGGCCTATACTTGG + Intronic
1188499468 X:30809704-30809726 CATACTGCCTGGCAAATAATGGG - Intergenic
1188550099 X:31354211-31354233 CACAGTACCTGGCATATAATAGG + Intronic
1188595509 X:31895001-31895023 CATACTGCCTGGCATATAAAAGG - Intronic
1190041350 X:47074829-47074851 CACTGTGCCTGGCCTATAGTAGG + Intergenic
1190850011 X:54230935-54230957 CCCATTGCCTGGCCTATAGTTGG - Intronic
1191180788 X:57561405-57561427 CACACTGAATGGGCAAAAATTGG + Intergenic
1192165491 X:68825107-68825129 CACACTGCCTGGCATACAGTAGG + Intergenic
1192586608 X:72323979-72324001 CACGCTGCATGGCACATAGTAGG + Intergenic
1193067278 X:77273940-77273962 CACACACCAGGGCCTATCATGGG + Intergenic
1194088537 X:89558406-89558428 CACACACCAGGGCCTGTAATGGG + Intergenic
1194793067 X:98174904-98174926 CATACTTCCTGGCCTATAATGGG + Intergenic
1194915154 X:99697862-99697884 CACACTGCCTGGTCTATCAAAGG - Intergenic
1195446832 X:104961793-104961815 CACAATGCCTGGCCCAGAATAGG + Intronic
1195693227 X:107646457-107646479 CACAGTGCCTGGCACATAATAGG + Intronic
1196111860 X:111954851-111954873 CACAGTGCCTGGCACATAATAGG - Intronic
1196645112 X:118109733-118109755 CACAATGCTTGGAATATAATAGG + Intronic
1197424189 X:126274419-126274441 CACAGTGTATGGCACATAATAGG + Intergenic
1198155260 X:133953781-133953803 CACAGTGCTTGGCATATAGTAGG - Intronic
1198384942 X:136119759-136119781 CACAGTGCATGGCATATAGTAGG + Intergenic
1198520439 X:137447019-137447041 CACAATGCCTGGCATATAGTAGG - Intergenic
1198560218 X:137841642-137841664 CACAGTGCCTGGCATATAGTAGG + Intergenic
1199402418 X:147414026-147414048 CACACAGCATAGCCTAAAATAGG - Intergenic
1200839218 Y:7763221-7763243 CATACTGAATGGCCAAAAATTGG + Intergenic
1201551912 Y:15226616-15226638 CACACACCAGGGCCTATAGTGGG + Intergenic