ID: 999977788

View in Genome Browser
Species Human (GRCh38)
Location 5:156929170-156929192
Sequence CCATGCCAGTGGCAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999977782_999977788 -8 Left 999977782 5:156929155-156929177 CCTTGTGAAAAGTAGCCATGCCA 0: 1
1: 0
2: 2
3: 5
4: 139
Right 999977788 5:156929170-156929192 CCATGCCAGTGGCAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999977788 Original CRISPR CCATGCCAGTGGCAAGGGGA TGG Intronic
No off target data available for this crispr