ID: 999981387

View in Genome Browser
Species Human (GRCh38)
Location 5:156960967-156960989
Sequence CCGTAGTGCCATGCATCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999981387_999981391 16 Left 999981387 5:156960967-156960989 CCTGAGGATGCATGGCACTACGG 0: 1
1: 0
2: 1
3: 2
4: 42
Right 999981391 5:156961006-156961028 GAGAATAGTACAAGTTTGAGAGG 0: 1
1: 0
2: 0
3: 15
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999981387 Original CRISPR CCGTAGTGCCATGCATCCTC AGG (reversed) Intronic
903952600 1:27004997-27005019 CCTTAGTGCCATGCTTCCTCTGG - Intergenic
904879202 1:33682066-33682088 CAGTAGGGCCATGCTCCCTCTGG + Intronic
916241615 1:162645573-162645595 CAGTAGAACCATGTATCCTCAGG + Intronic
1065240729 10:23701375-23701397 CGGTTGTGCCTTTCATCCTCAGG + Intronic
1067030522 10:42876564-42876586 CCGCAGTGCCATGCAGCGCCTGG + Intergenic
1069683097 10:70299261-70299283 CAGGAGTGCCATGCAGACTCTGG + Exonic
1083994519 11:66265557-66265579 CCGGAGGTCCATGCTTCCTCAGG + Intronic
1103006012 12:117420915-117420937 CCTTGGTGCCATGCAGCCTCTGG + Intronic
1103240191 12:119406821-119406843 CCCTAGTGTATTGCATCCTCTGG - Intronic
1108490303 13:50975058-50975080 CAGTCGTGCCATGCTTACTCTGG + Intergenic
1128599921 15:68987629-68987651 CAGCAGCGCCCTGCATCCTCTGG + Intronic
1128934718 15:71735367-71735389 CCTGAGTGCCATGGATCCTTAGG - Intronic
1137365900 16:47859237-47859259 ACTTACTGCCATGCAGCCTCGGG - Intergenic
1144661137 17:17071762-17071784 CCGGAGCCACATGCATCCTCTGG + Intronic
1146451090 17:32974626-32974648 GGGCATTGCCATGCATCCTCTGG + Intronic
1156962038 18:43043985-43044007 CTGTTCTGCCATGCTTCCTCTGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
925448538 2:3949259-3949281 CAGCATTGCCTTGCATCCTCAGG - Intergenic
925848013 2:8051238-8051260 CCGTTGTGAAATCCATCCTCAGG - Intergenic
927251690 2:21000436-21000458 CCGTATTGCCATGAAGCCCCTGG + Intergenic
931358827 2:61560404-61560426 CCATAGTGCCAGGCACTCTCAGG + Intergenic
940101809 2:150048714-150048736 CCTTAGTCCCATCCATTCTCAGG - Intergenic
940292688 2:152092775-152092797 CTGTAGTTCCAGGCATCCACTGG - Intronic
942399422 2:175585746-175585768 CCCTGGTGCCATCCATCCTGTGG - Intergenic
942607615 2:177709279-177709301 CTGGAGTGCCAAGCAGCCTCGGG + Intronic
1169942335 20:10950622-10950644 CAGTAGTGCAATTCACCCTCTGG - Intergenic
1184295140 22:43518550-43518572 CCGTATTTCCTTGCTTCCTCTGG + Intergenic
949422455 3:3880484-3880506 CCGTAGTTTCAGGCATCCACTGG - Intronic
949998144 3:9635311-9635333 CTGGAGTGCCATGCATGGTCTGG - Intergenic
954068480 3:48125787-48125809 CCCTAGTGCCATGTATCCAAGGG + Intergenic
976083357 4:81380866-81380888 CCATAGTGCCATGAAACCTTGGG + Intergenic
999981387 5:156960967-156960989 CCGTAGTGCCATGCATCCTCAGG - Intronic
1001217577 5:169870070-169870092 CCCATGTCCCATGCATCCTCAGG - Intronic
1036657993 8:10690282-10690304 GCCTTGTGCCATGCATGCTCTGG - Intronic
1039474028 8:37829956-37829978 CCCCAGTGCCCTGCATGCTCAGG + Exonic
1041434017 8:57817740-57817762 CAGTACTTTCATGCATCCTCTGG + Intergenic
1050206577 9:3202750-3202772 CAGTAGGGCCATGCTTCCTGTGG + Intergenic
1051067035 9:13116982-13117004 CCATAGTGTCAGGCATCCACTGG - Intronic
1061164627 9:128915208-128915230 CTGCAGTGCCAGGCATCCACGGG - Intronic
1061373534 9:130211312-130211334 CCCCAGAGCCATCCATCCTCTGG + Intronic
1062070836 9:134554165-134554187 CCGGAGTGCCCTCCATCCACAGG - Intergenic
1189044827 X:37579354-37579376 CCGTGGTTCCAGGCATCCACTGG - Intronic
1192503928 X:71669694-71669716 CCCAGATGCCATGCATCCTCCGG + Intergenic
1200917451 Y:8583792-8583814 CTGTAGAACCATGCAGCCTCAGG + Intergenic
1200917769 Y:8586283-8586305 CTGTAGAGCCATGCAGCCTCAGG + Intergenic
1200930279 Y:8690801-8690823 CTGTAGAACCATGCAGCCTCAGG - Intergenic