ID: 999990577

View in Genome Browser
Species Human (GRCh38)
Location 5:157046366-157046388
Sequence AGTTAGCTGGGAAAGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1860
Summary {0: 1, 1: 0, 2: 4, 3: 93, 4: 1762}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999990574_999990577 -3 Left 999990574 5:157046346-157046368 CCACTAAGGGAAACAAGGAGAGT 0: 1
1: 0
2: 0
3: 16
4: 174
Right 999990577 5:157046366-157046388 AGTTAGCTGGGAAAGATGACAGG 0: 1
1: 0
2: 4
3: 93
4: 1762
999990571_999990577 8 Left 999990571 5:157046335-157046357 CCCAGAGCTTACCACTAAGGGAA 0: 1
1: 0
2: 1
3: 8
4: 119
Right 999990577 5:157046366-157046388 AGTTAGCTGGGAAAGATGACAGG 0: 1
1: 0
2: 4
3: 93
4: 1762
999990572_999990577 7 Left 999990572 5:157046336-157046358 CCAGAGCTTACCACTAAGGGAAA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 999990577 5:157046366-157046388 AGTTAGCTGGGAAAGATGACAGG 0: 1
1: 0
2: 4
3: 93
4: 1762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999990577 Original CRISPR AGTTAGCTGGGAAAGATGAC AGG Intronic
900112905 1:1016205-1016227 AGTTAGCTGGGTGAGGTGGCGGG - Intergenic
900232973 1:1571282-1571304 AGTTAGCTGGGAGTGGTGGCAGG + Intronic
900347976 1:2220021-2220043 AATTAGCTGGGCATGATGACGGG + Intergenic
900378857 1:2373812-2373834 TGTTAGCTGGGAGAGGTCACAGG - Intronic
900669836 1:3844547-3844569 AATTAGCTGGGCATGATGGCAGG + Intronic
901029399 1:6298281-6298303 AATTAGCTGGGCATGGTGACGGG - Intronic
901047498 1:6406302-6406324 AATTAGCTGGGCATGATGGCGGG - Intergenic
901125671 1:6926877-6926899 AGTTAGCTGGGCATGGTGGCAGG - Intronic
901179446 1:7331089-7331111 AATTAGCTGGGAGTGATGGCAGG + Intronic
901280767 1:8032957-8032979 AGTTAGCTGGGAATGGTGGTGGG + Intergenic
901286711 1:8085729-8085751 AATTAGCTGGGCATGATGGCGGG - Intergenic
901377302 1:8848537-8848559 AATTAGCTGGGCATGATGGCAGG + Intergenic
901569746 1:10150709-10150731 AGTTAGCTGGGCATGGTGGCAGG + Intronic
901606062 1:10460375-10460397 AATTAGCTGGGCATGATGGCGGG - Exonic
901909454 1:12443992-12444014 AGTTAGCCGGGCACGATGGCGGG - Intronic
901961741 1:12831847-12831869 AATTAGCTGGGCATGATGGCAGG + Intergenic
901968350 1:12886630-12886652 AATTAGCTGGGCATGATGGCAGG + Intronic
901976433 1:12948008-12948030 AATTAGCTGGGCATGATGGCAGG + Intronic
902016825 1:13315153-13315175 AATTAGCTGGGCATGATGGCAGG - Intronic
902087830 1:13876861-13876883 AATTAGCTGGGCATGGTGACAGG - Intergenic
902429212 1:16349711-16349733 AATTAGCTGGGCATGATGGCAGG + Intronic
902533219 1:17103833-17103855 AATTAGCTGGGCACGATGGCAGG + Intronic
902673172 1:17989774-17989796 AGTAAGCTGGGGAAGCTGAGGGG + Intergenic
902863376 1:19261453-19261475 AATTAGCTGGGCATGGTGACGGG + Intergenic
902897282 1:19487422-19487444 AATTAGCTGGGCGGGATGACGGG + Intergenic
903011289 1:20332329-20332351 AATTAGCTGGGCATGATGGCGGG + Intronic
903118256 1:21195897-21195919 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
903147805 1:21386756-21386778 AATTAGCTGGGCACGATGATGGG + Intergenic
903149003 1:21391955-21391977 AATTAGCCGGGTGAGATGACGGG - Intergenic
903435634 1:23346828-23346850 AATTAGCTGGGCATGATGGCAGG - Intergenic
903610109 1:24604965-24604987 AATTAGCTGGGCATGGTGACAGG + Intronic
903796371 1:25931859-25931881 AATTAGCTGGGCATGATGGCGGG + Intergenic
903816712 1:26069158-26069180 AATTAGCTGGGTATGATGGCAGG + Intergenic
903842145 1:26251089-26251111 AATTAGCTGGGCATGATGGCGGG - Intronic
904097094 1:27987833-27987855 AATTAGCTGGGTATGATGGCAGG - Intronic
904098476 1:28001588-28001610 AATTAGCTGGGCATGGTGACGGG + Intronic
904153219 1:28460655-28460677 AGTTAGCTGGGGGTGGTGACAGG - Intronic
904227554 1:29036406-29036428 AATTAGCTGGGCATGATGGCGGG - Intronic
904229346 1:29054887-29054909 AATTAGCTGGGCATGATGGCAGG + Intronic
904474032 1:30752953-30752975 AATTAGCTGGGCATGATGGCGGG - Intronic
904520072 1:31088175-31088197 AGTTAGCTGGGCATGGTGACGGG + Intergenic
904610221 1:31721724-31721746 AGTTAGCTGGAGAGGATGATGGG - Intergenic
904661629 1:32089878-32089900 AATTAGCTGGGCATGATGGCGGG + Intronic
904687331 1:32270229-32270251 AGTTAGCTGGGCATGGTGGCTGG - Intronic
904713172 1:32447120-32447142 AATTAGCTGGGCATGGTGACGGG - Intergenic
904728545 1:32569540-32569562 AATTAGCTGGGCATGGTGACGGG - Intronic
904785643 1:32980538-32980560 AGTTAGCTGGGCATGGTGATAGG + Intergenic
904786017 1:32983668-32983690 AATTAGCTGGGCATGATGGCAGG - Intergenic
905098611 1:35498182-35498204 AATTAGCTGGGTATGATGATGGG + Intronic
905113921 1:35620811-35620833 AATTAGCTGGGCATGGTGACAGG - Intronic
905115751 1:35639103-35639125 AATTAGCTGGGCATGGTGACGGG + Intronic
905189109 1:36219571-36219593 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
905568373 1:38984377-38984399 AATTAGCTGGGCATGATGGCGGG - Intergenic
905693963 1:39961495-39961517 AATTAGCTGGGAATGGTGGCGGG - Intronic
905697221 1:39983711-39983733 AATTAGCTGGGCATGATGGCGGG - Intergenic
905701576 1:40020120-40020142 AATTAGCTGGGAATGGTGGCAGG - Intergenic
905846088 1:41233915-41233937 AGTAACCTGTGAAAGATCACAGG - Intronic
906010060 1:42514800-42514822 AATTAGCTGGGTATGATGGCAGG - Intronic
906083912 1:43113765-43113787 AGTTAGCTGGGGATGGTGACAGG - Intergenic
906173059 1:43744396-43744418 AATTAGCTGGGCATGATGGCGGG - Intronic
906219132 1:44064135-44064157 AGTTAGCTGGGAAACAAGGAAGG + Intergenic
906234535 1:44197135-44197157 AATTAGCTGGGCATGATGATGGG + Intergenic
906456143 1:45998874-45998896 AATTAGCTCGGAATGATGGCGGG - Intronic
906481194 1:46200019-46200041 AGTTAGCTGGGCGTGGTGACAGG + Intronic
906573803 1:46869265-46869287 AATTAGCTGGGCATGATGGCTGG + Intergenic
906616777 1:47238684-47238706 AATTAGCTGGGAGTGGTGACAGG - Intergenic
906769191 1:48469114-48469136 TATTAGCTGGGTATGATGACAGG - Intronic
906880038 1:49579646-49579668 AATTAGCTGGGCACGGTGACAGG - Intronic
906921619 1:50070591-50070613 AATTAGCTGGGCATGGTGACAGG + Intronic
907027764 1:51138539-51138561 AATTAGCTGGGCATGGTGACGGG - Intronic
907035436 1:51212119-51212141 AATTAGCTGGGCATGATGGCAGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907721158 1:56973609-56973631 AATTAGCTGGGCAAGGTGGCAGG - Intergenic
908186497 1:61657555-61657577 AATTAGCTGGGCATGATGGCAGG - Intergenic
908242702 1:62201075-62201097 AATTAGCTGGGCATGATGGCGGG - Intronic
908249198 1:62251841-62251863 AATTAGCTGGGCATGATGGCGGG + Intronic
908268773 1:62403074-62403096 AATTAGCTGGGCATGATGGCGGG + Intergenic
908497990 1:64714268-64714290 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
908536887 1:65086504-65086526 AGTTAGCTGGGTATGGTGGCGGG - Intergenic
908541838 1:65129514-65129536 AATTAGCTGGGTATGATGGCAGG + Intergenic
908556160 1:65258412-65258434 TGTTAGCATGAAAAGATGACAGG - Intronic
908756433 1:67473215-67473237 AGTTAGCCGGGAATGGTGGCAGG - Intergenic
908842039 1:68289662-68289684 AATTAGCTGGGCATGATGGCAGG - Intergenic
909248106 1:73315116-73315138 AATTAGCTGGGTAAGGTGGCGGG + Intergenic
909786896 1:79624276-79624298 AATTAGCTGGGCATGATGGCGGG - Intergenic
909937614 1:81571174-81571196 AATTAGCTGGGCATGATGGCAGG + Intronic
910223661 1:84915244-84915266 AGTTAGCTGGGCATGATGGCGGG - Intergenic
910565674 1:88640074-88640096 AGTTATCTGAGAATGATGGCAGG + Intergenic
910572668 1:88723260-88723282 AATTAGCTGGGCATGGTGACAGG - Intronic
910611956 1:89154493-89154515 AATTAGCTGGGCATGATGGCAGG - Intronic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910932795 1:92459280-92459302 AATTAGCCGGGAATGATGGCAGG - Intergenic
910982799 1:92975411-92975433 AATTAGCTGGGCATGATGGCGGG - Intergenic
911207263 1:95104514-95104536 AATTAGCTGGGCAAGGTGGCGGG + Intergenic
911807379 1:102228774-102228796 AATTAGCCGGGCAAGGTGACGGG + Intergenic
912355243 1:109049481-109049503 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
912920640 1:113863239-113863261 AGTTAGCTGGGCATGGTGGCAGG - Intronic
913672686 1:121112259-121112281 AATTAGCTGGGCATGATGGCTGG + Intergenic
913965036 1:143369898-143369920 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
914024461 1:143899631-143899653 AATTAGCTGGGCATGATGGCTGG + Intergenic
914059412 1:144195500-144195522 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
914119738 1:144770871-144770893 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
914155123 1:145080701-145080723 AGTTAGCTGGGCATGGTGGCGGG - Intronic
914234755 1:145799214-145799236 AATTAGCTGGGCATGATGGCAGG - Intronic
914662946 1:149807653-149807675 AATTAGCTGGGCATGATGGCTGG + Intronic
914723319 1:150307194-150307216 AATTAGCTGGGCATGATGGCGGG - Intronic
914811502 1:151032094-151032116 AATTAGCTGGGCATGATGGCAGG + Intronic
914820032 1:151094496-151094518 AATTAGCTGGGCATGATGGCAGG - Intronic
915135679 1:153729483-153729505 AGAAAGCTGGGTAAGAGGACAGG - Intronic
915170688 1:153975267-153975289 AATTAGCTGGGCATGATGGCGGG - Intronic
915189211 1:154134586-154134608 AATTAGCTGGGCGAGGTGACGGG + Intronic
915258141 1:154651517-154651539 AATTAGCTGGGCATGATGGCGGG - Intergenic
915328873 1:155096832-155096854 AATTAGCTGGGCATGATGGCGGG + Intergenic
915425836 1:155825892-155825914 AATTAGCTGGGCATGATGGCAGG + Intronic
915686250 1:157637796-157637818 AATTAGCTGGGCATGATGGCAGG - Intergenic
915976466 1:160393836-160393858 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
916026038 1:160834502-160834524 AATTAGCTGGGCATGATGGCAGG - Intronic
916621826 1:166506148-166506170 AGTTAGCTGGGCATGATGGCGGG - Intergenic
916798567 1:168191721-168191743 AGTTAGCTGGGCATGGTGGCGGG + Intronic
917044905 1:170848633-170848655 AGTTAGCTGGGCACGGTGGCGGG - Intergenic
917215523 1:172674529-172674551 AATTAGCTGGGCATGATGGCAGG - Intergenic
917665586 1:177222458-177222480 AATTAGCTGGGCATGATGGCAGG - Intronic
917698149 1:177550732-177550754 AATTAGCTGGGCATGGTGACAGG + Intergenic
917790303 1:178495062-178495084 AGTTAGCTGGGCAAAGGGACTGG - Intergenic
917816877 1:178720380-178720402 AATTAGCTGGGCAAGGTGATGGG - Intergenic
917852094 1:179073462-179073484 AATTAGCTGGGCACGATGGCGGG - Exonic
918224030 1:182463143-182463165 AATTAGCCGGGAATGGTGACAGG + Intronic
918236883 1:182589674-182589696 AGTGAGCTGAGAAAGGTGACAGG - Intergenic
918364199 1:183789299-183789321 AGTTAGCTGGGCATGGTGGCAGG + Intronic
918530154 1:185510679-185510701 AATTAGCTGGGTATGATGGCAGG + Intergenic
918682342 1:187371049-187371071 AATTAGCTGGGCAAGGTGGCGGG + Intergenic
919016155 1:192039343-192039365 AATTAGCTGGGCAAGGTGTCAGG - Intergenic
919053884 1:192544685-192544707 AATTAGCTGGGCATGATGGCAGG + Intergenic
919066859 1:192702884-192702906 AATTAGCTGGGTAAGGTGGCAGG + Intergenic
919267404 1:195287918-195287940 AGTTAGTTGGGAGATATGCCAGG + Intergenic
919404988 1:197167975-197167997 AGTTATCTGTGAATAATGACAGG - Intronic
919507148 1:198413454-198413476 AATTAGCTGGGCATGGTGACGGG + Intergenic
919613023 1:199770118-199770140 AATTAGCTGGGCATGATGGCGGG + Intergenic
919821182 1:201473033-201473055 AATTAGCTGGGCATGATGGCAGG - Intergenic
919917696 1:202149002-202149024 AATTAGCTGGGCAAGGTGGCAGG - Intronic
920129063 1:203717047-203717069 AATTAGCTGGGCATGATGGCGGG + Intronic
920166061 1:204036906-204036928 ACTTAGGAGGGACAGATGACAGG - Intergenic
920167024 1:204043334-204043356 AATTAGCTGGGGATGATGGCGGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920542686 1:206791449-206791471 AATTAGCTGGGCATGATGGCCGG - Intergenic
920639599 1:207739269-207739291 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
920778689 1:208966673-208966695 AATTAGCTGGGCATGATGGCGGG + Intergenic
920784397 1:209026883-209026905 AGCCAGCTGGGAAAGAAGTCTGG - Intergenic
921096162 1:211889037-211889059 AATTAGCTGGGCATGATGGCAGG + Intergenic
921104845 1:211966215-211966237 AGTTAACATGGAAAGATAACTGG - Intronic
921955726 1:220981537-220981559 AATTAGCTGGGCATGGTGACAGG - Intergenic
921999075 1:221455849-221455871 ACTTAGCCGGGAGAGGTGACGGG - Intergenic
922490219 1:226010519-226010541 AATTAGCTGGGTATGATGGCAGG - Intergenic
922518637 1:226226528-226226550 ACTTAGCTGGGCACGGTGACGGG + Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923042018 1:230326267-230326289 AGTTAGCTGGGCACGGTGGCAGG + Intronic
923162643 1:231329889-231329911 AATTAGCTGGGCATGATGGCGGG - Intergenic
923619955 1:235570543-235570565 AATTAGCTGGGCATGATGGCGGG - Intronic
923670127 1:236033157-236033179 AATTAGCTGGGCATGATGGCGGG + Intronic
924105204 1:240642622-240642644 AATTAGCTGGGCATGGTGACAGG - Intergenic
924148407 1:241101345-241101367 AATTAGCTGGGCATGGTGACAGG + Intronic
924149206 1:241110831-241110853 AATTAGCTGGGCATGATGGCGGG - Intronic
924319705 1:242836750-242836772 AATTAGCTGGGCATGATGGCAGG + Intergenic
924473106 1:244360733-244360755 AATTAGCTGGGCATGATGGCAGG + Intronic
924723596 1:246646129-246646151 AATTAGCTGGGCAAGGTGGCGGG + Intronic
924806867 1:247368289-247368311 AGTTTTCCGGGAAAGAGGACTGG - Intergenic
1062823228 10:550156-550178 AATTAGCTGGGCATGGTGACAGG - Intronic
1063017272 10:2091234-2091256 AATTATCTGGGAACGATGGCGGG + Intergenic
1063140876 10:3255525-3255547 AATTAGCTGGGCATGATGATGGG + Intergenic
1063171401 10:3513126-3513148 AGACAGCTGGGAGAGAAGACAGG - Intergenic
1063647369 10:7898395-7898417 AATTAGCTGGGCATGATGGCGGG + Intronic
1063872642 10:10435272-10435294 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1063935046 10:11068707-11068729 AATTAGCTGGGCATGGTGACAGG - Intronic
1064047893 10:12034654-12034676 AATTAGCTGGGCATGATGGCAGG + Intronic
1064058397 10:12117149-12117171 AATTAGCTGGGCATGATGGCGGG - Intronic
1064136803 10:12757998-12758020 AATTAGCTGGGCATGATGGCGGG - Intronic
1064165612 10:12982961-12982983 AGTTAGCTGGGCATGGTGGCGGG + Intronic
1064434012 10:15295062-15295084 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1064437833 10:15326774-15326796 AATTAGCTGGGTATGATGGCAGG - Intronic
1064468698 10:15613010-15613032 AATTAGCTGGGAATGATGGTGGG + Intronic
1064479986 10:15730009-15730031 AATTAGCTGGGCATGGTGACGGG - Intergenic
1064743712 10:18458912-18458934 AATTAGCTGGGCATGATGGCGGG - Intronic
1064990562 10:21253111-21253133 AATTAGCTGGGCATGATGGCAGG + Intergenic
1065007063 10:21389808-21389830 AATTAGCTGGGTACGGTGACAGG - Intergenic
1065281173 10:24140209-24140231 AATTAGCTGGGCAAGGTGGCAGG + Intronic
1065338925 10:24684785-24684807 AATTAGCCGGGCAAGATGGCGGG - Intronic
1065350298 10:24789592-24789614 AATTAGCTGGGCATGATGGCAGG + Intergenic
1065440339 10:25747158-25747180 AGTTTCCTGTGAAAGATGAGTGG - Intergenic
1065448377 10:25826916-25826938 AATTAGCTGGGAGTGATGATGGG - Intergenic
1065476218 10:26140533-26140555 AATTAGCTGGGCATGATGGCAGG + Intronic
1065547068 10:26832433-26832455 AATTAGCTGGGAATGGTGGCGGG + Intronic
1065555421 10:26910746-26910768 AGTTAGCTGGGCATGGTGGCTGG - Intergenic
1065720687 10:28626247-28626269 AATTAGCTGGGCATAATGACAGG - Intergenic
1065779760 10:29156402-29156424 AATTAGCTGGGCAAGGTGGCAGG - Intergenic
1066088761 10:31997055-31997077 AATTAGCTGGGCATGATGGCAGG - Intergenic
1066095933 10:32072060-32072082 AGTCAGCTGGTGAAGGTGACTGG - Intergenic
1066120520 10:32281816-32281838 AATTAGCTGGGCATGATGGCAGG - Intronic
1066127705 10:32358001-32358023 AATTAGCTGGGTAAGGTGGCAGG - Intronic
1066255187 10:33671768-33671790 ATATATATGGGAAAGATGACTGG + Intergenic
1066285371 10:33961031-33961053 AATTAGCTGGGCATGATGGCGGG - Intergenic
1066409573 10:35153740-35153762 AGATAGAAGGGAAAGATGAAAGG + Intronic
1066572575 10:36789454-36789476 AATTAGCTGGGCATGATGGCGGG + Intergenic
1066676545 10:37893478-37893500 AATTAGCTGGGCAAGGTGGCGGG + Intergenic
1066957621 10:42188051-42188073 AGTTAACTGGAGAAGATGACCGG - Intergenic
1067913232 10:50368503-50368525 AATTAGCTGGGCATGATGGCAGG - Intronic
1067984411 10:51125531-51125553 AATTAGCTGGGCATGATGGCGGG + Intronic
1068175798 10:53456706-53456728 AATTAGCTGGGCATGATGACGGG - Intergenic
1068219426 10:54025645-54025667 AATTAGCTGGGCATGGTGACAGG - Intronic
1069022582 10:63505166-63505188 AATTAGCTGGGAATGGTGGCGGG + Intergenic
1069195512 10:65546047-65546069 AATTAGCTGGGGATGATGATGGG + Intergenic
1069408990 10:68133172-68133194 AATTAGCTGGGCATGATGGCAGG - Intronic
1069506414 10:69002306-69002328 AATTAGCTGGGAATGGTGGCGGG - Intronic
1069538362 10:69273176-69273198 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1069602836 10:69719453-69719475 AATTAGCTGGGCATGATGGCTGG + Intergenic
1069693466 10:70369929-70369951 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1069904807 10:71725992-71726014 AGGCAGCTGGGAGAGGTGACTGG - Intronic
1069954918 10:72044117-72044139 AATTAGCTGGGCATGGTGACAGG + Intergenic
1069978171 10:72232393-72232415 ACTTAGCTGGGCACGATGGCGGG + Intronic
1069989250 10:72304459-72304481 AATTAGCTGGGCATGGTGACAGG - Intergenic
1070000114 10:72370023-72370045 AATTAGCTGGGCATGATGGCGGG - Intronic
1070078010 10:73157196-73157218 AATTAGCTGGGCATGATGGCGGG - Intronic
1070094183 10:73320623-73320645 AGTTAAATGGGAAAGAAGGCTGG - Intronic
1070141234 10:73739868-73739890 AATTAGCTGGGCATGATGGCAGG + Intergenic
1070316467 10:75317845-75317867 AATTAGCTGGGCATGATGGCAGG + Intergenic
1070384834 10:75915282-75915304 AATTAGCTGGGCATGATGGCAGG - Intronic
1070400209 10:76046631-76046653 AATTAGCTGGGCATGATGGCAGG - Intronic
1070535647 10:77375334-77375356 GGCCAGCTGGGAAAGATGCCAGG - Intronic
1070909232 10:80103001-80103023 AATTAGCTGGGAATGGTGGCAGG - Intergenic
1071031858 10:81194408-81194430 AATTAGCTGGGAGAGGTGGCGGG + Intergenic
1071819855 10:89268835-89268857 AGTTAGCTGGGCGCGGTGACGGG + Intronic
1072094257 10:92161418-92161440 AATTAGCTGGGCAAGGTGGCAGG - Intronic
1072141870 10:92596150-92596172 AATTAGCCGGGAGAGATGGCAGG - Intronic
1072216549 10:93291975-93291997 AATTAGCTGGGCAGGGTGACGGG + Intergenic
1072475297 10:95754158-95754180 AATTAGCTGGGCAAGGTGGCGGG + Intronic
1072651542 10:97299593-97299615 AATTAGCTGGGCATGATGGCAGG + Intergenic
1072655959 10:97330688-97330710 AGTTAGCTGGGAGTGGTGGCGGG + Intergenic
1072834038 10:98692293-98692315 AGTTAGCTGGGACAGAATAAGGG + Intronic
1072893296 10:99344181-99344203 AATTAGCTGGGCATGATGGCGGG + Intronic
1072956250 10:99890793-99890815 AATTAGCTGGGCATGATGGCAGG - Intronic
1072965611 10:99970142-99970164 AGTTAGCAAGGAAAGATGGTAGG - Intronic
1073269837 10:102253041-102253063 AATTAGCTGGGCATGATGGCAGG - Intronic
1073737997 10:106371912-106371934 AGTTAGCTGGGCAGGGTGGCAGG + Intergenic
1074323042 10:112421305-112421327 AATTAGCTGGGCATGATGGCAGG - Intronic
1074572870 10:114640376-114640398 AATTAGCTGGGCATGGTGACGGG + Intronic
1074596825 10:114875545-114875567 AGATAGCTGGGCATGATGGCGGG + Intronic
1074822291 10:117189537-117189559 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1075038570 10:119089450-119089472 ATTAACATGGGAAAGATGACAGG - Intergenic
1075059530 10:119245869-119245891 AGTTAGCTGGGCATGGTGGCGGG + Intronic
1075060707 10:119254904-119254926 AGTTAGCTGGGCATGTTGGCAGG + Intronic
1075148705 10:119906722-119906744 AATTAGCTGGGCATGGTGACAGG - Intronic
1075331435 10:121576984-121577006 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1075382085 10:122027890-122027912 AATTAGCTGGGCATGGTGACAGG - Intronic
1075388371 10:122074227-122074249 AATTAGCTGGGCAAGTTGGCAGG - Intronic
1075631003 10:124000622-124000644 AGTTAGCTGGGCATGATAGCAGG + Intergenic
1075772615 10:124952757-124952779 AATTAGCTGGGAATGTTGGCGGG - Intronic
1076025474 10:127108436-127108458 AATTAGCTGGGCATGATGGCGGG + Intronic
1076104917 10:127814031-127814053 AATTAGCTGGGCATGGTGACGGG + Intergenic
1076127705 10:127988452-127988474 AATTAGCTGGGCATGGTGACAGG - Intronic
1076757715 10:132581984-132582006 AATTAGCTGGGCATGGTGACAGG - Intronic
1077133189 11:985130-985152 AGTTAGCCGGGTATGATGGCAGG - Intronic
1077203096 11:1323227-1323249 AATTAGCTGGGCACGATGGCAGG + Intergenic
1077203136 11:1323723-1323745 AGAAAGCCGGAAAAGATGACTGG + Intergenic
1077203344 11:1325627-1325649 AGATAGCTGGAAAAGATGACTGG + Intergenic
1077401198 11:2358466-2358488 GGTTATCTGTGAATGATGACAGG - Intergenic
1077613061 11:3656529-3656551 AATTAGCTGGGCATGATGGCAGG - Intronic
1077932626 11:6750519-6750541 AATTAGCTGGGCATGATGGCAGG + Intergenic
1078024908 11:7685577-7685599 AGTTATCTGAGAAAGCTGCCTGG - Intergenic
1078206630 11:9235507-9235529 AATTAGCTGGGCACGATGGCGGG + Intronic
1078748781 11:14140541-14140563 AATTAGCTGGGCATGATGGCAGG - Intronic
1079062511 11:17261844-17261866 AATTAGCTGGGCATGATGATGGG - Intronic
1079161965 11:18003553-18003575 AATTAGCTGGGAATGGTGCCAGG + Intronic
1079562352 11:21838102-21838124 ACTGAGTTGGGAAAGATCACAGG - Intergenic
1080206581 11:29736312-29736334 AATTAGCTGGGCATGATGGCGGG + Intergenic
1080498822 11:32848821-32848843 AATTAGCTGGGCATGATGGCAGG + Intronic
1080546571 11:33324893-33324915 AATTTGCTGGGGAAGATGCCTGG - Intronic
1080627269 11:34041899-34041921 AATTAGCTGGGCATGATGGCAGG + Intergenic
1080805778 11:35651989-35652011 AATTAGCTGGGCATGATGGCAGG - Intergenic
1081200234 11:40206382-40206404 AATTAGCTGGGCATGATGGCAGG - Intronic
1081471771 11:43380402-43380424 AATTAGCTGGGCATGATGGCAGG - Intronic
1081674563 11:44961046-44961068 ACTGAGCTGGGAAGGATGAATGG + Intergenic
1081900937 11:46627228-46627250 AATTAGCTGGGCATGATGGCAGG + Intronic
1082055107 11:47808130-47808152 AATTAGCTGGGCATGATGGCAGG + Intronic
1082236537 11:49824538-49824560 AATTAGCTGGGAATGATGGTGGG + Intergenic
1082841423 11:57693156-57693178 AATTAGCTGGGCAAGGTGGCAGG + Intronic
1082956920 11:58880005-58880027 AATTAGCTGGGCAAGGTGGCGGG - Intronic
1082979258 11:59104879-59104901 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1083019056 11:59487576-59487598 AATTAGCTGGGCATGATGGCCGG + Intergenic
1083236697 11:61355530-61355552 AATTAGCTGGGCATGATGGCGGG + Intronic
1083250942 11:61466654-61466676 AATTAGCTGGGCATGATGATGGG + Intronic
1083294606 11:61708527-61708549 AATTAGCTGGGCATGATGGCGGG - Intronic
1083575353 11:63786949-63786971 AATTAGCTGGGCATGATGGCAGG - Intergenic
1083630794 11:64094281-64094303 AGTTAGCCGGGCATGGTGACAGG + Intronic
1083639699 11:64138914-64138936 AATTAGCTGGGCATGATGGCAGG - Intronic
1083754201 11:64781075-64781097 AATTAGCTGGGCATGATGGCAGG - Intergenic
1083870530 11:65485240-65485262 AATTAGCTGGGCATGATGGCGGG + Intergenic
1084106653 11:66984998-66985020 AGGAAGCTGGGGAAGATGTCTGG - Intergenic
1084108573 11:66997822-66997844 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1084186964 11:67478340-67478362 AATTAGCTGGGAATGTTGGCAGG + Intergenic
1084442451 11:69182486-69182508 AGGTGGCTGGGATAGCTGACAGG + Intergenic
1084749762 11:71196847-71196869 AGTTAGCTGGGCATGGTGGCGGG + Intronic
1084932686 11:72569678-72569700 AATTAGCTGGGCATGGTGACGGG + Intergenic
1085196193 11:74673218-74673240 AGTAAGCTGGGGAAGCTGCCAGG + Intergenic
1085285850 11:75360282-75360304 AATTAGCTGGGCATGATGGCAGG - Intergenic
1085356463 11:75842588-75842610 AATTAGCTGGGAATGATGGCGGG - Intronic
1085436789 11:76511549-76511571 AATTAGCCGGGCATGATGACAGG + Intronic
1085704366 11:78772889-78772911 AGCCTGCTGGGAAAGATGAGAGG + Intronic
1085900822 11:80698139-80698161 AATTAGCTGGGCATGATGGCGGG + Intergenic
1085981333 11:81730106-81730128 AATTAGCTGGGTCTGATGACAGG - Intergenic
1086106442 11:83152894-83152916 AATTAGCTGGGAATGATGGTGGG + Intergenic
1086282873 11:85210927-85210949 AGATACCTGTGAAAGATGAAGGG - Intronic
1086363155 11:86080335-86080357 AATTAGCTGGGCATGATGGCGGG - Intergenic
1086388194 11:86332107-86332129 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1086514826 11:87599683-87599705 AATTAGCTGGGCATGATGGCAGG - Intergenic
1086657451 11:89376907-89376929 AATTAGCTGGGCATGATGGCAGG + Intronic
1086938196 11:92767098-92767120 AATTAGCTGGGCATGATGGCGGG + Intronic
1087199209 11:95328701-95328723 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1087258891 11:95988405-95988427 AATTAGCTGGGCATGATGGCGGG - Intronic
1087288099 11:96288391-96288413 AATTAGCTGGACATGATGACAGG + Intronic
1087645572 11:100804659-100804681 AATTAGCTGGGCATGGTGACAGG - Intronic
1088044274 11:105428545-105428567 AATTAGCTGGGCATGGTGACAGG + Intergenic
1088403066 11:109442245-109442267 AATTAGCTGGGCATGGTGACGGG - Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1089145218 11:116324434-116324456 AATTAGCTGGGCATGATGGCGGG - Intergenic
1089147567 11:116340986-116341008 AATTAGCTGGGCATGATGGCGGG + Intergenic
1089183749 11:116600821-116600843 AATTAGCTGGGCATGATAACGGG + Intergenic
1089226032 11:116923063-116923085 AATTAGCTGGGCATGATGGCGGG - Intronic
1089236126 11:117027609-117027631 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1089239816 11:117067836-117067858 AATTAGCTGGGCATGGTGACAGG + Intronic
1089460021 11:118647563-118647585 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1089465272 11:118680880-118680902 AATTAGCTGGGCATGATGGCGGG + Intergenic
1089519877 11:119056688-119056710 AGTGAGCTGGGAAAGGGGAGGGG - Intronic
1089758474 11:120705372-120705394 AATTAGCTGGGCAAGGTGGCAGG - Intronic
1089955741 11:122569440-122569462 AATTAGCTGGGCATGGTGACAGG + Intergenic
1089975071 11:122725116-122725138 AATTAGCTGGGCATGGTGACGGG - Intronic
1090009027 11:123029550-123029572 AATTAGCTGGGCATGATGGCAGG - Intergenic
1090038797 11:123272159-123272181 AATTAGCTGGGCATGATGACGGG + Intergenic
1090063945 11:123487753-123487775 AATTAGCTGGGCATGATGGCGGG - Intergenic
1090246970 11:125223376-125223398 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1090292700 11:125559423-125559445 AGTTAGCTGGGTATGGTGGCAGG + Intergenic
1090353338 11:126122005-126122027 AATTAGCTGGGCATGATGGCAGG - Intergenic
1090636584 11:128693737-128693759 AGCTAGCCGGGAACAATGACGGG - Intronic
1090814863 11:130283819-130283841 AATTAGCTGGGCATGATGGCAGG + Intronic
1091479979 12:817802-817824 AATTAGCTGGGCATGATGGCGGG + Intronic
1091483051 12:854504-854526 AATTAGCTGGGCATGATGGCGGG - Intronic
1091535344 12:1402379-1402401 AGTTAGCTGGGCATGGTGGCGGG + Intronic
1091861838 12:3792479-3792501 AATTAGCTGGGCATGATGGCAGG + Intronic
1092139097 12:6170586-6170608 AATTAGCTGGGCATGATGGCAGG + Intergenic
1092159715 12:6309839-6309861 AATTAGCTGGGCATGGTGACGGG - Intergenic
1092176182 12:6408925-6408947 AATTAGCTGGGTATGATGGCAGG + Intergenic
1092376240 12:7957841-7957863 AATTAGCCGGGCATGATGACGGG - Intergenic
1092380293 12:7990676-7990698 AATTAGCTGGGCATGATGGCAGG - Intergenic
1092618776 12:10239788-10239810 AATTAGCTGGGCATGATGGCGGG - Intergenic
1092791563 12:12075269-12075291 AATTAGCTGGGCATGATGGCAGG - Intronic
1092835692 12:12485940-12485962 AATTAGCTGGGCGAGGTGACAGG - Intronic
1092994066 12:13931499-13931521 AGTTAGATGGAAAAAATGTCAGG - Intronic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093048926 12:14484995-14485017 AGTTACCTGCAAAAGATGGCAGG + Intronic
1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG + Intronic
1093265019 12:16992427-16992449 AATTAGCTGGGCATGATGGCCGG - Intergenic
1093411963 12:18878051-18878073 AATTAGCTGGGCATGGTGACAGG + Intergenic
1093455044 12:19356807-19356829 AATTAGCTGGGCATGATGGCGGG - Intronic
1093551339 12:20415584-20415606 AATTAGCTGGGCATGATGGCGGG - Intronic
1093733795 12:22595554-22595576 GGTCAGGTGGGAAAGATGTCTGG - Intergenic
1093969316 12:25360554-25360576 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1094221432 12:27997871-27997893 AATTAGCTGGGTAAGGTGGCAGG + Intergenic
1094595003 12:31857195-31857217 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1094820066 12:34217712-34217734 AGTTAGCTGGGTGTGATGGCAGG + Intergenic
1095237326 12:39812976-39812998 AATTAGCTGGGCATGATGTCAGG - Intronic
1095684884 12:45022450-45022472 AGTTAGCTGGGCGAGGTGGCTGG - Intronic
1096095017 12:48928969-48928991 AGTTAGCTGGGCGTGATGGCGGG - Intronic
1096173055 12:49489448-49489470 ATTTATCTGGAAAAGATGACAGG - Exonic
1096286851 12:50307865-50307887 AATTAGCTGGGCATGGTGACCGG - Intergenic
1096343279 12:50822188-50822210 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1096369020 12:51052955-51052977 AATTAGCTGGGCATGATGGCAGG + Intronic
1096374531 12:51097394-51097416 AATTAGCTGGGCATGATGGCAGG - Intronic
1096406047 12:51344974-51344996 AATTAGCTGGGCATGGTGACAGG + Intronic
1096662598 12:53136802-53136824 AATTAGCTGGGCATGGTGACGGG - Intergenic
1096698397 12:53365880-53365902 AGTTAGCTGGGCATGGTGTCAGG - Intergenic
1096728082 12:53581535-53581557 AGATAGCTGGAAAATATGAAAGG + Intronic
1096903477 12:54909784-54909806 AATTAGCTGGGCATGATGGCGGG + Intergenic
1097356913 12:58612455-58612477 AATTAGCTGGGAATGGTGGCAGG + Intronic
1097578669 12:61426704-61426726 ATTTAGCTGGGCATGATGGCAGG - Intergenic
1097710158 12:62909139-62909161 AGTTTGAAAGGAAAGATGACAGG - Intronic
1097814383 12:64056162-64056184 ATTTAGGAGGTAAAGATGACAGG - Intronic
1097911131 12:64970441-64970463 AATTAGCTGGGCATGATGGCGGG + Intergenic
1097982497 12:65748786-65748808 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1098017470 12:66121429-66121451 AGTTAGCTGGGCATGGTGGCAGG - Exonic
1098195021 12:67990739-67990761 AATTAGCTGGGCATGGTGACAGG - Intergenic
1098342127 12:69463017-69463039 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1098528324 12:71512138-71512160 AATTAGCTGGGCATGATGGCGGG - Intronic
1098738819 12:74144249-74144271 AATTAGCTGGGCATGGTGACGGG + Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099966778 12:89455184-89455206 AATTAGCTGGGCATGATGGCAGG + Intronic
1100261295 12:92934672-92934694 AATTAGCTGAGCATGATGACAGG + Intergenic
1100297120 12:93273600-93273622 AATTAGCTGGGCATGATGGCGGG - Intergenic
1100301878 12:93315131-93315153 AATTAGCTGGGCATGATGGCGGG + Intergenic
1100422520 12:94450398-94450420 AGTTAGCTGGGAGTGGTGGCGGG - Intronic
1100471274 12:94895416-94895438 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1100684954 12:96977672-96977694 AATTAGCTGGGCATGATGGCGGG - Intergenic
1100766643 12:97873386-97873408 AATTAGCTGGGAATGGTGGCAGG - Intergenic
1100926140 12:99550473-99550495 AGTTAGCTGGGCATGGTGGCTGG + Intronic
1101010783 12:100446937-100446959 AATTAGCTGGGCATGGTGACGGG + Intergenic
1101068424 12:101047098-101047120 AATTAGCTGGGCATGATGGCGGG + Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101480955 12:105096743-105096765 AATTAGCTGGGCACGATGGCAGG - Intergenic
1101678989 12:106946475-106946497 AATTAGCTGGGCATGGTGACAGG + Intergenic
1102127625 12:110497746-110497768 AGTTAGCTGGGCACGGTGGCAGG + Intronic
1102128671 12:110506986-110507008 AATTAGCTGGGCATGATGGCAGG - Intronic
1102271733 12:111542377-111542399 AATTAGCTGGGCGAGGTGACGGG - Intronic
1102290256 12:111693387-111693409 AATTATCTGGGCATGATGACAGG + Intronic
1102311506 12:111848560-111848582 AATTAGCTGGGCATGATGGCAGG - Intronic
1102439424 12:112949868-112949890 AATTAGCTGGGCATGGTGACGGG + Intronic
1102692653 12:114773552-114773574 AATTAGCTGGGCAGGGTGACAGG - Intergenic
1103217777 12:119216021-119216043 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1103376566 12:120460854-120460876 AATTAGCTGGGTGTGATGACAGG + Exonic
1103423144 12:120806698-120806720 AATTAGCTGGGCATGGTGACGGG + Intronic
1103574230 12:121865117-121865139 AATTAGCTGGGCATGATGGCGGG + Intergenic
1103773055 12:123343684-123343706 AATTAGCTGGGCATGATGATGGG - Intronic
1104023558 12:125009951-125009973 AATTAGCTGGGTATGATGGCAGG + Intronic
1104138467 12:125962938-125962960 AATTAGCTGGGCATGGTGACAGG + Intergenic
1104455013 12:128903877-128903899 AATTAGCTGGGCATGATGGCGGG - Intronic
1104486056 12:129152024-129152046 AATTAGCTGGGCATGATGGCGGG - Intronic
1104495858 12:129237988-129238010 TTTTAGCAGGGAAAGATGATGGG + Intronic
1104508797 12:129357096-129357118 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1104865631 12:131951748-131951770 AATTAGCTGGGCATGATGGCAGG - Intronic
1105270001 13:18864074-18864096 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1105391239 13:19980602-19980624 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1105793228 13:23823678-23823700 AATTAGCTGGGCATGATAACAGG + Intronic
1106236497 13:27865532-27865554 AATTAGCTGGGCACGATGACAGG + Intergenic
1106282690 13:28289731-28289753 AGTTAGCCGGGCATGGTGACAGG + Intronic
1106315911 13:28593102-28593124 AATTAGCTGGGCATGATGGCGGG - Intergenic
1106605151 13:31222225-31222247 AGTTAGCCGGGCATGATGGCAGG - Intronic
1106725367 13:32478984-32479006 AATTAGTTGGGAATGATGGCGGG + Intronic
1106761706 13:32874391-32874413 AATTAGCTGGGCATGGTGACAGG + Intergenic
1106787505 13:33121992-33122014 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1107112318 13:36711513-36711535 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1107515666 13:41126290-41126312 AATTAGCTGGGCGTGATGACAGG - Intergenic
1107536457 13:41339705-41339727 AATTAGCTGGGCATGGTGACAGG - Intronic
1107677501 13:42812089-42812111 AGTTAGCTGGGTATGGTGGCAGG - Intergenic
1107714266 13:43183674-43183696 AATTAGCTGGGCATGATGGCGGG + Intergenic
1107769494 13:43774994-43775016 AATTAGCTGGGCATGATGGCAGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108388571 13:49924825-49924847 AATTAGCTGGGAATGGTGGCAGG + Intronic
1108538211 13:51408290-51408312 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1108774738 13:53751802-53751824 AATTAGCTGGGCATGATGGCAGG + Intergenic
1110070204 13:71165665-71165687 AATTAGCTGGGCATGATGGCAGG - Intergenic
1110840393 13:80135445-80135467 AATTAGCTGGGCATGGTGACAGG + Intergenic
1110861885 13:80353451-80353473 AATTAGCTGGGCATGATGGCAGG + Intergenic
1111070852 13:83166412-83166434 AGTTTGCTTGGAAAGAAAACTGG - Intergenic
1111363788 13:87212897-87212919 AATTAGCTGGGCATGATGGCGGG + Intergenic
1111585495 13:90278486-90278508 AATTAGCTGGGAGTGATGGCGGG - Intergenic
1111627725 13:90811061-90811083 AATTAGCTGGGCATGATGGCAGG - Intergenic
1111797757 13:92945188-92945210 AGTTAGCTGTGAAAGAGGCTGGG - Intergenic
1112013902 13:95315586-95315608 AATTAGCTGGGCATGATGGCAGG + Intergenic
1112368997 13:98778417-98778439 AATTAGCTGGGCATGGTGACAGG - Intergenic
1112417205 13:99213507-99213529 AATTAGCTGGGCATGATGGCAGG - Intronic
1112428287 13:99325249-99325271 AATTAGCTGGGCATGGTGACAGG - Intronic
1112524623 13:100132926-100132948 AGTTAGCTGGGCATAGTGACAGG - Intronic
1112646351 13:101337455-101337477 AATTAGCTGGGCATGATGGCGGG - Intronic
1112670113 13:101625699-101625721 AATTAGCTGGGCATGATGGCAGG - Intronic
1112909099 13:104459908-104459930 AATTAGCTGGGCATGATGGCGGG - Intergenic
1113071710 13:106427895-106427917 AATTAGCTGGGCATGATGTCAGG + Intergenic
1113233607 13:108242883-108242905 AATTAGCTGGGCAAGGTGGCAGG - Intergenic
1113326932 13:109291382-109291404 AATTAGCTGGGCATGATGACGGG - Intergenic
1113423098 13:110185292-110185314 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1113475541 13:110578089-110578111 AGTTAGCTGGGTGTGGTGACGGG + Intergenic
1113543403 13:111126339-111126361 AATTAGCTGGGCATGATGGCGGG + Intronic
1113828533 13:113275857-113275879 AATTAGCTGGGCATGATGGCGGG - Intergenic
1113846019 13:113392194-113392216 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1113982442 13:114287953-114287975 AATTAGCTGGGCATGATGGCGGG - Intronic
1114007508 14:18330992-18331014 AATTAGCTGGGCATGATGGCAGG + Intergenic
1114290452 14:21283803-21283825 AGTTAGCTGGGCATGGTGACAGG - Intergenic
1114302022 14:21386686-21386708 AATTAGCTGGGCAAGGTGGCGGG + Intronic
1114458763 14:22873671-22873693 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1114581840 14:23768051-23768073 AATTAGCTGGGCATGATGGCAGG - Intergenic
1114622637 14:24105767-24105789 AATTAGCTGGGCATGATGGCAGG + Intronic
1114791244 14:25660911-25660933 TTTTAGCTGGGAAACCTGACTGG - Intergenic
1115040593 14:28920424-28920446 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115412802 14:33094612-33094634 AATTAGCTGGGCATGATGGCAGG - Intronic
1115552640 14:34518480-34518502 AATTAGCTGGGCATGATGGCGGG - Intronic
1115555694 14:34543582-34543604 AATTAGCTGGGCATGATGGCGGG - Intergenic
1115558214 14:34559511-34559533 AATTAGCTGGGCATGATGGCGGG + Intergenic
1115984494 14:39089805-39089827 AATTAGCTGGGCATGATGGCGGG + Intronic
1116358927 14:43968146-43968168 AATTAGCTGGGCATGATGGCAGG + Intergenic
1116451871 14:45075805-45075827 AATTAGCTGGGCATGGTGACGGG - Intergenic
1116739083 14:48732585-48732607 AATTAGCTGGGCATGGTGACGGG - Intergenic
1116804112 14:49474970-49474992 AGTTAGCTGGTAAAGGGAACAGG - Intergenic
1116922810 14:50598507-50598529 AATTAGCTGGGCATGATGGCGGG - Intronic
1117190283 14:53283288-53283310 AATTAGCTGGGCATGATGGCAGG - Intergenic
1117402082 14:55367593-55367615 AATTAGCTGGGCATGATGGCAGG + Exonic
1117516946 14:56511405-56511427 AATTAGCTGGGCAAGGTGGCGGG + Intronic
1117537955 14:56719713-56719735 AATTAGCTGGGCATGATGGCAGG - Intronic
1117663329 14:58030770-58030792 AGTTAGTTCTGAAATATGACAGG - Intronic
1117702893 14:58432863-58432885 AATTAGCTGGGCATGATGGCAGG - Intronic
1117943584 14:60994553-60994575 AATTAGCTGGGCATGATGGCGGG + Intronic
1118031279 14:61820628-61820650 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1118217785 14:63825724-63825746 AATTAGCTGGGAATGGTGGCGGG + Intergenic
1118374590 14:65165587-65165609 AATTAGCTGGGCATGATGGCAGG + Intergenic
1118831526 14:69437735-69437757 AATTAGCTGGGCATGATGGCAGG - Intronic
1118852785 14:69597215-69597237 AATTAGCTGGGCATGATGGCAGG + Intergenic
1119097984 14:71851930-71851952 AGTTAGCTGGGTGGGATGGCGGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1119353932 14:73989682-73989704 AATTAGCTGGGCATGATGGCGGG + Intronic
1119515573 14:75245675-75245697 AATTAGCTGGGCATGATGGCAGG + Intronic
1119680631 14:76589971-76589993 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1120018406 14:79500568-79500590 TGTTAGATGGGAAAGATGAAAGG - Intronic
1120233781 14:81867808-81867830 AATTAGCTGGGCATGATGGCGGG + Intergenic
1120269148 14:82288907-82288929 AATTAGCTGGGCATGGTGACAGG - Intergenic
1120527908 14:85599064-85599086 AATTAGCCGGGCATGATGACGGG - Intronic
1120542554 14:85768132-85768154 AATTAGCTGGGCATGATGGCAGG + Intergenic
1120721133 14:87890883-87890905 AATTAGCTGGGCATGATGGCAGG - Intronic
1120873541 14:89359145-89359167 AATTAGCTGGGCATGGTGACAGG + Intronic
1121058363 14:90879930-90879952 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1121130513 14:91441585-91441607 AATTAGCTGGGCATGATGGCGGG - Intergenic
1122484953 14:102073055-102073077 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1122702462 14:103599024-103599046 AATTAGCTGGGCATGATGGCAGG + Intronic
1122728271 14:103775421-103775443 AATTAGCTGGGCATGATGGCAGG - Intronic
1122762763 14:104042222-104042244 AGGCAGCTGAGAAAGTTGACTGG - Intronic
1122872020 14:104643096-104643118 AATTAGCTGGGCATGGTGACGGG + Intergenic
1122949802 14:105036609-105036631 ACTTAGCTGGGCATGATGGCGGG - Intergenic
1122950353 14:105041128-105041150 AATTAGCTGGGCATGATGGCAGG + Intergenic
1202872916 14_GL000225v1_random:180553-180575 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1123448862 15:20347984-20348006 AATTAGCTGGGCATGATGGCAGG + Intergenic
1123739615 15:23224127-23224149 AGTTAGCCGGGCAAGGTGGCGGG + Intergenic
1124290836 15:28453098-28453120 AGTTAGCCGGGCAAGGTGGCGGG + Intergenic
1124810913 15:32937191-32937213 AGCTAACAGGGAAAGATGCCAGG - Intronic
1124900666 15:33819523-33819545 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1125022529 15:34999365-34999387 AATTAGCTGGGCATGATGGCAGG + Intergenic
1125064743 15:35468917-35468939 AATTAGCTGGGCATGATGGCAGG + Intronic
1125082180 15:35687834-35687856 AATTAGCTGAGCAAGGTGACAGG + Intergenic
1125294746 15:38190659-38190681 AGACAGCTGGGAAAGATGGGAGG - Intergenic
1125321412 15:38493324-38493346 AATTAGCTGGGCATGATGGCAGG - Intronic
1125332156 15:38592948-38592970 AATTAGCCGGGAAAGGTGGCGGG + Intergenic
1125797764 15:42416181-42416203 TGCTAGCTGGGAAAGAAGAGTGG - Exonic
1125912473 15:43453691-43453713 AATTAGCCTGGAATGATGACGGG - Intronic
1126003238 15:44231529-44231551 AATTAGCTGGGCACGATGGCAGG + Intergenic
1126168647 15:45675541-45675563 AATTAGCTGGGCATGGTGACAGG - Intronic
1126419134 15:48453105-48453127 AGTTAGCTGGGCATGGTGGCGGG + Intronic
1126594828 15:50374865-50374887 AATTAGCTGGGCATGATGGCGGG + Intergenic
1126601856 15:50436644-50436666 AATTAGCTGGGCATGATGTCAGG - Intronic
1126761571 15:51974508-51974530 AGTTAGCAGGGCATGGTGACGGG + Intronic
1126763296 15:51989226-51989248 AATTAGCAGGGCATGATGACGGG - Intronic
1126781510 15:52143004-52143026 AATTAGCTGGGCAAGGTGGCAGG + Intronic
1127123454 15:55790568-55790590 AATTAGCCGGGCAAGATGGCGGG + Intergenic
1127265714 15:57359957-57359979 AATTAGCTGGGCATGATGGCAGG + Intergenic
1127441936 15:59017904-59017926 AATTAGCTGGGCATGATGGCAGG - Intronic
1127475048 15:59325182-59325204 AATTAGCTGGGCATGGTGACGGG - Intronic
1127502097 15:59563469-59563491 AATTAGCTGGGCATGATGGCGGG - Intergenic
1127506907 15:59606754-59606776 AATTAGCTGGGCATGGTGACGGG - Intronic
1127942176 15:63709902-63709924 AGGTAGCTGGGAAAGCTTTCTGG + Intronic
1127945534 15:63747309-63747331 AATTAGCTGGGCATGATGGCGGG + Intronic
1128690118 15:69717980-69718002 AATTAGCTGGGCATGGTGACAGG + Intergenic
1128817812 15:70627053-70627075 AGTTAGCTGGGCGTGGTGACTGG - Intergenic
1128950677 15:71877604-71877626 AATTAGCTGGGCATGATGGCAGG - Intronic
1129247781 15:74290324-74290346 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1129250305 15:74305093-74305115 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1129282454 15:74496501-74496523 AATTAGCTGGGCATGGTGACGGG + Intergenic
1129347372 15:74931350-74931372 AATTAGCTGGGCGTGATGACGGG + Intronic
1129427605 15:75475428-75475450 AATTAGCTGGGCACGATGGCAGG + Intronic
1129438736 15:75563335-75563357 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1129669691 15:77600503-77600525 AGTTAGCTGGGAAAGAATGAAGG + Intergenic
1129698190 15:77752552-77752574 TGTTGGATGGGAAAGATTACAGG + Intronic
1129765070 15:78159570-78159592 TGGTAGCTGGGAGTGATGACTGG + Intronic
1129863321 15:78881342-78881364 AATTAGCTGGGCATGGTGACAGG - Intronic
1129939562 15:79482442-79482464 AATTAGCTGGGCATGATGGCAGG - Intergenic
1129974535 15:79811272-79811294 AGGTGGCTGGGCCAGATGACCGG + Intergenic
1130343648 15:83021603-83021625 AGTTAGCTGGGCATGATAGCAGG + Intronic
1130401851 15:83563785-83563807 AATTAGCCGGGCATGATGACGGG - Intronic
1130513964 15:84611597-84611619 AATTAGCTGGGAGTGATGGCAGG + Intronic
1130644251 15:85709834-85709856 AATTAGCTGGGCATGGTGACGGG - Intronic
1130658644 15:85812215-85812237 AATTAGCTGGGCATGATGTCAGG - Intergenic
1131190800 15:90315063-90315085 AATTAGCTGGGCATGATGGCAGG + Intergenic
1131238212 15:90715353-90715375 AGCTAGCTGGGCATGATGGCGGG + Intergenic
1131280284 15:91015529-91015551 AATTAGCTGGGCAAGGTGGCAGG + Intronic
1131300578 15:91196345-91196367 AGTTACATGGAAAAGGTGACAGG + Intronic
1131480354 15:92775395-92775417 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1131617849 15:94035026-94035048 AATTAGCTGGGCACGATGGCAGG + Intergenic
1132016121 15:98318792-98318814 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1132045994 15:98563088-98563110 AGCTAGCTGGGAAAGACTTCTGG + Intergenic
1132127074 15:99237128-99237150 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1132167413 15:99608750-99608772 AGTTAGCTGGGCGTGATGGCAGG + Intronic
1132466673 16:80658-80680 AATTAGCTGGGTGTGATGACGGG + Intronic
1132490995 16:230897-230919 AGTTAGTCGGGAATGATGGCGGG - Intergenic
1132515850 16:365604-365626 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1132539231 16:500537-500559 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1132596009 16:750320-750342 AATTAGCTGGGCATGGTGACCGG + Intronic
1132819458 16:1856302-1856324 AATTAGCTGGGCATGGTGACAGG - Intronic
1132850178 16:2021481-2021503 AATTAGCTGGGCGAGGTGACGGG - Intergenic
1133079751 16:3309305-3309327 AATTAGCTGGGCATGATGACCGG + Intronic
1133101592 16:3483304-3483326 AGTTAGGAAGGAAGGATGACTGG - Intronic
1133124472 16:3636973-3636995 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1133140984 16:3743925-3743947 AATTAGCTGGGCAAGGTGGCGGG + Intronic
1133291609 16:4726122-4726144 AATTAGCTGGGCATGGTGACGGG - Intronic
1133439781 16:5811280-5811302 AATTAGCTGGGCATGATGGCGGG - Intergenic
1133464367 16:6016182-6016204 AGTAAGCTGAGACAAATGACAGG + Intergenic
1133499397 16:6351520-6351542 AGTTAGCTGGGCAGGGTGGCAGG - Intronic
1133545666 16:6804154-6804176 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1133617059 16:7487046-7487068 AATTAGCTGGGCATGATGGCAGG - Intronic
1133657502 16:7880238-7880260 AATTAGCTGGGCATGATGGCGGG - Intergenic
1133681657 16:8125644-8125666 AATTAGCTGGGCATGATGGCGGG - Intergenic
1133780488 16:8935356-8935378 AATTAGCTGGGCATGATGGCAGG - Intronic
1133939835 16:10299543-10299565 AGTTAGCTGGGTATGGTGGCAGG + Intergenic
1134161112 16:11890107-11890129 AATTAGCTGGGCAAGGTGGCAGG - Intronic
1134269062 16:12717788-12717810 AATTAGCTGGGCATGGTGACAGG - Intronic
1134432295 16:14221928-14221950 AATTAGCTGGGCATGATGGCGGG - Intronic
1134605450 16:15567612-15567634 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1134694188 16:16210944-16210966 AATTAGCTGGGCATGATGGCAGG + Intronic
1134977651 16:18583698-18583720 AATTAGCTGGGCATGATGGCAGG - Intergenic
1135114814 16:19715563-19715585 AATTAGCTGGGCATGATCACGGG - Intronic
1135115511 16:19719820-19719842 AATTAGCCAGGAATGATGACGGG - Intronic
1135569992 16:23542005-23542027 AATTAGCTGGGCATGATGGCGGG - Intronic
1135617719 16:23926333-23926355 AATTAGCTGGGCATGATGGCGGG + Intronic
1135731497 16:24898665-24898687 AATTAGCTGGGCATGGTGACGGG - Intronic
1135791037 16:25396163-25396185 AGTTTGCTGGGAAAGGTGACTGG - Intergenic
1136100014 16:27987066-27987088 AATTAGCTGGGCAAGGTGGCAGG + Intronic
1136114927 16:28088525-28088547 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1136183426 16:28570724-28570746 AATTAGCTGGGCATGATGGCAGG - Intronic
1136189069 16:28604852-28604874 AATTAGCTGGGCATGATGATGGG - Intergenic
1136241791 16:28949154-28949176 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1136316730 16:29458870-29458892 AATTAGCTGGGCATGATGGCGGG - Intergenic
1136356288 16:29746401-29746423 AATTAGCTGGGCATGGTGACGGG + Intergenic
1136357265 16:29753264-29753286 AATTAGCTGGGCATGGTGACGGG - Intergenic
1136369438 16:29826776-29826798 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1136431305 16:30198212-30198234 AATTAGCTGGGCATGATGGCGGG - Intronic
1136487801 16:30584499-30584521 AATTAGCTGGGCATGATGGCGGG + Intronic
1136595156 16:31243675-31243697 AATTAGCTGGGCATGGTGACAGG + Intergenic
1136649375 16:31654261-31654283 AATTAGCTGGGCACGATGTCTGG + Intergenic
1136707922 16:32204559-32204581 AGTTAGCTGGGCAAGGTGGCAGG - Intergenic
1136759987 16:32724852-32724874 AGTTAGCCGGGCAAGGTGGCGGG + Intergenic
1136808117 16:33145534-33145556 AGTTAGCCGGGCAAGGTGGCGGG - Intergenic
1137600643 16:49753880-49753902 AATTAGCTGGGAATGGTGGCGGG + Intronic
1137992043 16:53168208-53168230 AATTAGCTGGGCATGATGGCAGG - Intronic
1138734546 16:59235406-59235428 AATTAGCTGGGTGAGGTGACGGG - Intergenic
1139053516 16:63153952-63153974 AATTAGCTGGGCATGATGGCAGG + Intergenic
1139219123 16:65161060-65161082 AATTAGCTGGGCATGATGGCGGG + Intergenic
1139221070 16:65182554-65182576 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1139259110 16:65575270-65575292 AATTAGCTGGGCAAGGTGGCGGG + Intergenic
1139560736 16:67740249-67740271 AATTAGCTGGGCATGATGGCGGG - Intronic
1139760154 16:69178346-69178368 AATTAGCTGGGCATGATGGCAGG + Intronic
1139766479 16:69234849-69234871 AATTAGCTGGGCATGGTGACGGG - Intronic
1139772051 16:69285939-69285961 ACTTAGCTGGGTATGATGGCAGG - Intronic
1139811772 16:69625046-69625068 AATTAGCTGGGCATGGTGACGGG - Intronic
1139822871 16:69734577-69734599 AATTAGCTGGGCATGATGATGGG - Intergenic
1139876075 16:70147081-70147103 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1139906287 16:70368419-70368441 AATTAGCTGGGCATGATGGCGGG - Intronic
1140215439 16:73003555-73003577 AATTAGCTGGGAGTGATGGCGGG + Intronic
1140359715 16:74334015-74334037 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1140556478 16:75927106-75927128 AATTAGCTGGGCACGATGATGGG + Intergenic
1140770927 16:78203286-78203308 AGATGACTGGGGAAGATGACTGG + Intronic
1140782855 16:78312521-78312543 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1140829107 16:78735013-78735035 AGTTAGCTGGGCATGATGGTGGG - Intronic
1140857140 16:78988193-78988215 ACTTAGCTGGGCATGGTGACAGG + Intronic
1141417726 16:83889506-83889528 AATTAGCTGGGCATGATGGCAGG - Intergenic
1141560606 16:84865302-84865324 AATTAGCTGGGCATGATGGCGGG - Intronic
1141735057 16:85846803-85846825 GGTTCTCTGGGAAAGAAGACGGG + Intergenic
1142204640 16:88777119-88777141 AATTAGCTGGGTATGGTGACAGG - Intronic
1142391792 16:89806059-89806081 AATTAGCTGGGCAAGGTGGCAGG - Intronic
1203062142 16_KI270728v1_random:985173-985195 AGTTAGCCGGGCAAGGTGGCGGG + Intergenic
1142565875 17:839946-839968 AATTAGCTGGGCAAGGAGACAGG + Intronic
1142628443 17:1207498-1207520 AATTAGCTGGGAATGGTGGCAGG + Intronic
1142705519 17:1691326-1691348 AATTAGCTGGGCATGATGGCGGG - Intergenic
1142720153 17:1770606-1770628 AATTAGCTGGGCATGATGGCAGG - Intronic
1142791699 17:2271564-2271586 AATTAGCTGGGCATGATGGCGGG + Intronic
1142819538 17:2454711-2454733 AATTAGCTGGGCATGATGGCGGG - Intronic
1142836211 17:2589319-2589341 ACTTAGCTGGGCATGGTGACGGG + Intergenic
1142857608 17:2740512-2740534 AATTAGCTGGGCATGGTGACAGG + Intergenic
1143024884 17:3935684-3935706 AATTAGCTGGGCATGATGGCAGG - Intronic
1143082302 17:4390762-4390784 AATTAGCTGGGCATGGTGACGGG - Intergenic
1143160882 17:4870054-4870076 AGTTAGCTGGGCATGATGGCGGG - Intronic
1143249237 17:5510506-5510528 AATTAGCTGGGCATGATGGCAGG - Intronic
1143440484 17:6968789-6968811 AATTAGCTGGGCATGATGGCGGG - Intronic
1143500503 17:7336050-7336072 AGTTAGCCGGGCATGATGGCAGG + Intergenic
1143564486 17:7713351-7713373 ACTTAGCTGGGCAAGGTGGCGGG - Intergenic
1143789492 17:9282279-9282301 AATTAGCTGGGCATGATGGCAGG - Intronic
1143802337 17:9394511-9394533 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1143814692 17:9502955-9502977 AATTAGCTGGGCATGATGGCGGG + Intronic
1143947940 17:10610574-10610596 AATTAGCTGGGCATGATGGCGGG - Intergenic
1144165324 17:12604751-12604773 AATTAGCTGGGCATGATGATGGG - Intergenic
1144174300 17:12689680-12689702 AATTAGCTGGGCATGATGGCAGG + Intronic
1144178420 17:12730297-12730319 AATTAGCTGGGCATGGTGACAGG + Intronic
1144180737 17:12749996-12750018 AATTAGCTGGGCATGATGGCGGG - Intronic
1144196611 17:12901070-12901092 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1144503604 17:15810002-15810024 AATTAGCTGGGCATGGTGACGGG + Intergenic
1144862310 17:18312959-18312981 AATTAGCTGGGCATGGTGACAGG + Intronic
1145057180 17:19710599-19710621 AATTAGCTGGGCATGATGGCGGG - Intronic
1145075628 17:19852370-19852392 AGTTAGCTGGGCATGGTGGCCGG + Intronic
1145166640 17:20617679-20617701 AATTAGCTGGGCATGGTGACGGG + Intergenic
1146139548 17:30353338-30353360 AATTAGCTGGGCATGATGGCAGG - Intergenic
1146146929 17:30427031-30427053 AATTAGCTGGGCATGATGGCAGG + Intronic
1146201280 17:30860960-30860982 AGTTAGCTGGGCATGATGGTGGG - Intronic
1146333641 17:31950927-31950949 AATTAGCTGGGCAAGGTGGCGGG - Intronic
1146396316 17:32470459-32470481 AATTAGCTGGGCATGATGGCAGG - Intronic
1146427316 17:32753747-32753769 AATTAGCTGGGCATGATGGCAGG + Intronic
1146474174 17:33148943-33148965 AATTAGCTGGGCATGATGGCAGG + Intronic
1146861081 17:36299458-36299480 AATTAGCTGGGAATGGTGGCAGG + Intronic
1146905541 17:36615508-36615530 AATTAGCTGGGCATGATGGCAGG + Intergenic
1147008513 17:37424293-37424315 AATTAGCTGGGCATGATGGCGGG + Intronic
1147091412 17:38103562-38103584 AATTAGCTGGGAATGGTGGCAGG + Intergenic
1147105800 17:38216943-38216965 AATTAGCTGGGAATGGTGGCAGG - Intergenic
1147112193 17:38271485-38271507 AATTAGCTGGGCATGATGATGGG - Intergenic
1147205965 17:38837527-38837549 AATTAGCTGGGCATGATGGCAGG + Intronic
1147217739 17:38910869-38910891 AATTAGCTGGGCATGATGGCAGG - Intronic
1147760223 17:42793357-42793379 AATTAGCTGGGCATGATGGCGGG - Intronic
1147860549 17:43519790-43519812 AATTAGCTGGGCATGATGGCGGG + Intronic
1148010939 17:44480720-44480742 AATTAGCTGGGTACGATGACAGG + Intronic
1148011852 17:44488935-44488957 AATTAGCTGGGCATGATGGCGGG + Intronic
1148097685 17:45064672-45064694 AATTAGCTGGGCATGATGGCAGG + Intronic
1148375857 17:47145750-47145772 AATTAGCTGGGCATGATGGCGGG + Intronic
1148417377 17:47517340-47517362 AATTAGCTGGGCATGATGATGGG + Intergenic
1148423708 17:47571567-47571589 AATTAGCTGGGAATGGTGGCAGG + Intronic
1148543205 17:48496570-48496592 AGTTAGCTGGGCATGCTGGCGGG + Intergenic
1148592694 17:48828629-48828651 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1148609826 17:48957586-48957608 AATTAGCTGGGCATGATGACAGG - Intergenic
1148730199 17:49830024-49830046 AATTAGCTGGGCATGGTGACAGG - Exonic
1148943519 17:51237145-51237167 AATTAGCTGGGCATGATGGCAGG + Intronic
1149428196 17:56575946-56575968 AATTAGCTGGGCATGGTGACGGG + Intergenic
1149539736 17:57459978-57460000 AATTAGCTGGGCGTGATGACAGG + Intronic
1149713823 17:58768097-58768119 AATTAGCTGGGCAAGGTGGCAGG - Intronic
1149731394 17:58950211-58950233 AATTAGCTGGGCATGATGGCGGG + Intronic
1149784326 17:59422679-59422701 AATTAGCTGGGCATGATGGCGGG - Intergenic
1149820179 17:59768835-59768857 AATTAGCTGGGCATGATGACAGG + Intronic
1149821674 17:59785539-59785561 AATTAGCTGGGCATGATGGCAGG + Intronic
1149988312 17:61365480-61365502 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1150037984 17:61825134-61825156 AATTAGCTGGGCAAGGTGGCGGG + Intronic
1150112333 17:62513025-62513047 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1150185111 17:63172328-63172350 AATTAGCTGGGAATGGTGGCGGG - Intronic
1150212551 17:63449183-63449205 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1150241650 17:63638875-63638897 AATTAGCTGGGCATGATGATAGG + Intronic
1150273069 17:63879208-63879230 AATTAGCTGGGCAAGGTGGCGGG - Intronic
1150298798 17:64031108-64031130 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1150490427 17:65570449-65570471 AATTAGCTGGGAATGGTGGCAGG + Intronic
1150672356 17:67212170-67212192 AATTAGCTGGGCATGATGGCAGG + Intronic
1150779849 17:68112521-68112543 AGTTAGCTGGGCATGCTGGCGGG + Intergenic
1150868840 17:68881955-68881977 AGACAGCTGGCAATGATGACTGG + Exonic
1150877887 17:68989905-68989927 AGACAGCTGGCAATGATGACGGG + Exonic
1151288269 17:73129258-73129280 AATTAGCTGGGCATGATGGCAGG + Intergenic
1151442851 17:74144573-74144595 AATTAGCTGGGCATGATGGCGGG - Intergenic
1151444588 17:74154848-74154870 AATTAGCTGGGCATGATGGCGGG + Intergenic
1151523197 17:74645838-74645860 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1151578807 17:74966134-74966156 AATTAGCTGGGCATGGTGACGGG + Intronic
1151621522 17:75248320-75248342 AGTTAGCTGGGCAAGGTGGCGGG + Intronic
1151644827 17:75423336-75423358 AATTAGCTGGGTATGGTGACGGG - Intergenic
1151761742 17:76108003-76108025 AGTTAGCTGGGCGTGGTGACGGG - Intronic
1151812934 17:76455300-76455322 AATTAGCTGGGCAAGGTGGCAGG + Intronic
1151864889 17:76794839-76794861 AATTAGCTGGGCATGGTGACGGG - Intergenic
1151899198 17:77000572-77000594 AGTTAGCTGGGTGCGATGGCGGG + Intergenic
1152050586 17:77972361-77972383 AATTAGCTGGGCATGATGGCAGG + Intergenic
1152052598 17:77993108-77993130 AATTAGCTGGGCATGATGGCGGG - Intergenic
1152369037 17:79873943-79873965 AATTAGCTGGGCATGATGGCGGG - Intergenic
1152432460 17:80256774-80256796 AATTAGCTGGGAGAGGTGGCGGG - Intergenic
1152438727 17:80292231-80292253 AGTTAGCTGGGGGTGGTGACAGG - Intronic
1152832543 17:82507220-82507242 AATTAGCTGGGCATGATGGCGGG - Intergenic
1153339127 18:3956495-3956517 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1153671140 18:7413430-7413452 AATTAGCAGGGCATGATGACGGG - Intergenic
1153691076 18:7594329-7594351 AATTAGCTGGGCATGATGGCAGG + Intronic
1153708576 18:7773727-7773749 AATTAGCTGGGCATGATGGCAGG - Intronic
1153733908 18:8044606-8044628 AGTTAGCTGGGCATGATGGTAGG + Intronic
1153790232 18:8572356-8572378 AATTAGCTGGGCATGGTGACAGG - Intergenic
1154242452 18:12664845-12664867 AGTTAGCTGGGCATGGTGACGGG - Intronic
1154277413 18:12974426-12974448 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1154391408 18:13939741-13939763 AATTAGCTGGGAGAGGTGGCAGG - Intergenic
1154418037 18:14195905-14195927 AATTAGCTGGGCAAGGTGGCAGG - Intergenic
1154511219 18:15104597-15104619 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1154529961 18:15332977-15332999 AATTAGCTGGGCATGATGGCGGG - Intergenic
1154967331 18:21372770-21372792 AATTAGCTGGGCATGATGGCGGG + Intronic
1155025623 18:21937875-21937897 AGTTAGCTGGGAGTGGTGGCGGG + Intergenic
1155147803 18:23098337-23098359 AATTAGCTGGGCATGATGACGGG + Intergenic
1155151068 18:23123306-23123328 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1155218603 18:23664480-23664502 AATTAGCTGGGCACGGTGACAGG - Intergenic
1155336664 18:24771989-24772011 AATTAGCTGGGCATGATGGCGGG + Intergenic
1155414712 18:25584798-25584820 AATTAGCTGGGCATGATGACAGG - Intergenic
1155657184 18:28206042-28206064 AATTAGCTGGGCACGATGGCGGG - Intergenic
1155950183 18:31902898-31902920 AATTAGCTGGGCAAGGTGGCGGG + Intronic
1155976656 18:32139218-32139240 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1156412082 18:36840167-36840189 AGTTAGCTGGGACAGTTGTAGGG + Intronic
1156553747 18:38044506-38044528 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1156840518 18:41605165-41605187 AGTCAGCAGGGAAAGAGGAATGG + Intergenic
1156949882 18:42882533-42882555 GGTTAGCTGGTGAAAATGACTGG + Intronic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157609153 18:48945311-48945333 AATTAGCTGGGCATGGTGACGGG + Intronic
1157746319 18:50139025-50139047 AGTTATCTGGGGAAGGTAACTGG - Intronic
1157835130 18:50894417-50894439 AATTAGCTGGGCATGATGGCGGG + Intronic
1157874005 18:51254904-51254926 AATTAGCTGGGCATGATGGCAGG - Intergenic
1158115198 18:53987437-53987459 AGTTAGCCGGGCATGGTGACAGG + Intergenic
1158199316 18:54922528-54922550 AGTTACTAGGAAAAGATGACTGG + Intronic
1158482900 18:57837473-57837495 AATTAGCTGGGAGTGATGGCAGG + Intergenic
1158588356 18:58759748-58759770 AATTAGCTAGGCATGATGACAGG + Intergenic
1158614750 18:58976679-58976701 AATTAGCTGGGCATGATGGCAGG - Intronic
1158858688 18:61570620-61570642 AATTAGCTGGGCATGTTGACAGG + Intergenic
1158875360 18:61729116-61729138 AATTAGCTGGGCATGGTGACAGG - Intergenic
1158998294 18:62946412-62946434 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1159507291 18:69353936-69353958 AATTAGCTGGGCATGATGGCGGG + Intergenic
1159538450 18:69744775-69744797 AGTTAGCTGGGCGTGGTGACGGG + Intronic
1160126323 18:76175692-76175714 AGTCATCTGGGAAAGATATCTGG + Intergenic
1160210853 18:76877357-76877379 AATTAGCTGGGCACGATGGCAGG + Intronic
1160478340 18:79214997-79215019 AATTAGCTGGGCATGATGACGGG + Intronic
1160759159 19:773947-773969 AATTAGCTGGGCATGGTGACGGG + Intergenic
1160880953 19:1319912-1319934 AATTAGCTGGGTATGGTGACAGG - Intergenic
1161121797 19:2531154-2531176 AATTAGCTGGGCATGATGGCGGG + Intronic
1161184962 19:2911382-2911404 AATTAGCTGGGCATGATGGCGGG + Intronic
1161334815 19:3707203-3707225 AATTAGCTGGGCATGATGGCTGG + Intergenic
1161558747 19:4958824-4958846 AATTAGCTGGGTGAGGTGACAGG + Intronic
1161644968 19:5447557-5447579 AATTAGCCGGGCAAGATGGCGGG + Intergenic
1161677375 19:5659528-5659550 AATTAGCTGGGCATGATGGCAGG - Intronic
1161776596 19:6266128-6266150 AGTTAGCTGGGTATGGTGGCGGG + Intronic
1161822778 19:6540778-6540800 AATTAGCTGGGCATGGTGACAGG + Intergenic
1161825412 19:6560681-6560703 AATTAGCTGGGGAAGGTGGCAGG + Intergenic
1161896634 19:7086878-7086900 AATTAGCTGGGCGTGATGACAGG + Intronic
1161910553 19:7190518-7190540 AATTAGCTGGGCGTGATGACGGG - Intronic
1162012471 19:7826050-7826072 AATTAGCCGGGCATGATGACAGG + Intergenic
1162204507 19:9045664-9045686 AATTAGCTGGGCATGATGACGGG + Intergenic
1162306433 19:9877079-9877101 ATTTAGCTGGGCATGATGGCGGG + Intronic
1162410854 19:10504162-10504184 AATTAGCTGGGTATGATGGCGGG - Intergenic
1162447577 19:10733030-10733052 AATTAGCTGGGCATGGTGACAGG - Intronic
1162764701 19:12911764-12911786 AATTAGCTGGGCATGATGGCAGG - Intronic
1163102074 19:15103961-15103983 AATTAGCTGGGCATGGTGACAGG + Intergenic
1163120792 19:15216400-15216422 AATTAGCTGGGCATGATGGCTGG - Intergenic
1163194236 19:15703388-15703410 AGTTAGCTGGGCACGGTGGCAGG - Intergenic
1163371224 19:16902366-16902388 AGTTAGTTGGGCATGATGGCGGG + Intronic
1163409883 19:17147393-17147415 AATTAGCTGGGCATGATGGCAGG + Intronic
1163536084 19:17877456-17877478 AATTAGCTGGGAATAATGGCGGG - Intronic
1163651992 19:18523154-18523176 AATTAGCTGGGCATGATGGCGGG - Intergenic
1163741390 19:19015650-19015672 AATTAGCTGGGCATGGTGACAGG - Intronic
1163911008 19:20192452-20192474 AATTAGCTGGGCATGGTGACAGG - Intronic
1164167261 19:22692351-22692373 AATTAGCTGGGCATGATGGCAGG - Intergenic
1164223128 19:23214793-23214815 AATTAGCTGGGCATGATGGCGGG - Intergenic
1164275464 19:23713611-23713633 AATTAGCTGGGCATGATGGCAGG + Intergenic
1164297871 19:23931117-23931139 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1164300940 19:23962657-23962679 AATTAGCTGGGCATGGTGACGGG + Intergenic
1164317363 19:24103871-24103893 ACTTAGCTGGGAATGGTGGCAGG - Intronic
1164651875 19:29896430-29896452 AGTTAGCTGGGCATGATGGGGGG + Intergenic
1164656798 19:29927723-29927745 AATTAGCTGGGCATGATGGCAGG - Intronic
1165035718 19:33032167-33032189 AATTAGCTGGGTATGGTGACAGG - Intronic
1165247905 19:34508220-34508242 AATTAGCTGGGAGTGATGGCAGG - Exonic
1165577449 19:36833289-36833311 AATTAGCTGGGCATGATGGCTGG - Intronic
1165590756 19:36967412-36967434 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1165599687 19:37043620-37043642 AATTAGCTGGGCATGGTGACAGG - Intronic
1165682310 19:37788520-37788542 AATTAGCTGGGCATGATGGCGGG + Intronic
1165731433 19:38148200-38148222 AGTTAGCTGGGTACGGTGGCAGG + Intronic
1165833670 19:38742175-38742197 AATTAGCTGGGCATGATGGCGGG + Intronic
1165836047 19:38756821-38756843 AATTAGCTGGGAATGGTGGCAGG + Intronic
1165944223 19:39431872-39431894 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1166169559 19:41018224-41018246 AGGCAGCTGGGAATGAGGACTGG - Exonic
1166326806 19:42056131-42056153 AATTAGCTGGGCATGATGGCAGG - Intronic
1166530618 19:43541053-43541075 AATTAGCTGGGCATGATGGCAGG + Intergenic
1166761396 19:45226583-45226605 AATTAGCTGGGCATGATGGCAGG - Intronic
1166949608 19:46417754-46417776 AATTAGCTGGGCACGATGGCAGG + Intergenic
1166951637 19:46432340-46432362 AATTAGCTGGGCATGATGGCGGG - Intergenic
1167002049 19:46751525-46751547 AGTTAGCTGGGCATGGTGACAGG - Intronic
1167042486 19:47030800-47030822 AATTAGCTGGGCATGATGGCGGG - Intronic
1167128346 19:47567405-47567427 AATTAGCTGGGCATGATGGCGGG - Intergenic
1167232304 19:48292644-48292666 AATTAGCTGGGCATGATGGCGGG - Intergenic
1167402867 19:49284471-49284493 AATTAGCTGGGCATGATGGCGGG + Intergenic
1167478026 19:49712192-49712214 AATTAGCTGGGTATGGTGACAGG + Intronic
1167480578 19:49728197-49728219 AATTAGCTGGGCATGATGGCGGG + Intergenic
1168226192 19:54997054-54997076 AGTTAGCTGGGCGTGGTGACAGG - Intronic
1168230133 19:55025851-55025873 AATTAGCTGGGCATGATGGCAGG + Intronic
1168564923 19:57414857-57414879 AGTTAGCCGGGCATGATGGCAGG - Intronic
1202633834 1_KI270706v1_random:25306-25328 AGTTAGCTGGGCATGGTGGCTGG - Intergenic
925203778 2:1989847-1989869 AGTTAGCTGGGCATGGTGGCGGG + Intronic
925259165 2:2515266-2515288 AGTTAGCTGGGCACGGTGGCAGG - Intergenic
925494465 2:4431338-4431360 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
925938320 2:8789434-8789456 AATTAGCCGGGCAAGATGGCGGG - Intronic
926292942 2:11544961-11544983 AGTTAGCTGGGCATGGTGGCAGG - Intronic
926546760 2:14251200-14251222 AATTAGCTGGGCATGATGGCGGG - Intergenic
927176597 2:20414014-20414036 AATTAGCTGGGCATGATGGCTGG - Intergenic
927341217 2:21984834-21984856 AGTAAACAGGGAAACATGACTGG + Intergenic
927368600 2:22328373-22328395 AGTTAGCTGAGAGAGATGCATGG - Intergenic
927530643 2:23795728-23795750 AATTAGCTGGGCATGATGGCAGG + Intronic
927539064 2:23891167-23891189 AATTAGCTGGGCATGATGGCGGG - Intronic
927539711 2:23898091-23898113 AATTAGCTGGGCATGATGGCAGG - Intronic
927671321 2:25071107-25071129 AATTAGCTGGGCATGGTGACGGG - Intronic
927677892 2:25120200-25120222 AATTAGCTGGGCATGATGGCAGG + Intronic
927747586 2:25635280-25635302 AGTTAGCTGGGTATGGTGGCGGG + Intronic
927792642 2:26022478-26022500 AATTAGCTGGGCATGATGGCAGG - Intergenic
927820826 2:26263148-26263170 AATTAGCTGGGCATGATGGCAGG + Intronic
927994010 2:27469681-27469703 AATTAGCTGGGCATGGTGACAGG + Intronic
928057401 2:28071753-28071775 AGTCAACTTGGAAGGATGACAGG - Intronic
928128572 2:28632637-28632659 AGTTAGCTGGGCGTGATGGCAGG + Intronic
928157601 2:28890947-28890969 AATTAGCTGGGCATGATGGCGGG + Intergenic
928403813 2:30998876-30998898 AGTTGGCTGAGGAAAATGACAGG - Intronic
928571468 2:32613527-32613549 AATTAGCTGGGCATGATGGCAGG - Intronic
928640603 2:33294725-33294747 AATTAGCTGGGCATGATGGCGGG - Intronic
928721803 2:34130021-34130043 AATTAGCTGGGTATGGTGACAGG - Intergenic
928798218 2:35052131-35052153 AATTAGCTGGGCATGATGACGGG + Intergenic
929000165 2:37340408-37340430 AATTAGCTGGGAATGGTGGCAGG - Intergenic
929011720 2:37451675-37451697 AATTAGCCGGGCAAGGTGACAGG - Intergenic
929154345 2:38775847-38775869 AATTAGCTGGGCATGGTGACAGG + Intronic
929418465 2:41767582-41767604 AGTTAGCTGGGCACAATGGCAGG - Intergenic
929535196 2:42778476-42778498 AATTAGCTGGGCATGGTGACAGG - Intronic
929599788 2:43197962-43197984 AATTAGCTGGGCATGATGGCGGG - Intergenic
930078361 2:47426294-47426316 AATTAGCTGGGCATGGTGACGGG - Intronic
930106360 2:47642962-47642984 AGTTAGCTGGGGACCATGTCAGG - Intergenic
930118402 2:47739717-47739739 AGTTAGCTGGGCATGGTGGCAGG + Intronic
930302147 2:49629968-49629990 AGGAAGCTGGGGAAGAGGACAGG + Intergenic
930651080 2:53965816-53965838 AGTTAGCCGGGCATGATGGCGGG - Intronic
930706046 2:54505973-54505995 AATTAGCTGGGCGAGGTGACGGG + Intronic
930884451 2:56308919-56308941 AGTGAGCTGGGAAAAGTGAGGGG + Intronic
931050642 2:58410324-58410346 AGTCAGCATGGAAAAATGACTGG - Intergenic
931401497 2:61935477-61935499 AATTAGCTGGGCATGATGGCAGG + Intronic
931440503 2:62287109-62287131 AATTAGCTGGGCATGATGGCGGG - Intergenic
931560302 2:63554502-63554524 AATTAGCTGGGTATGATGGCAGG + Intronic
931678330 2:64720394-64720416 AATTAGCTGGGAATGGTGGCAGG + Intronic
932165727 2:69504616-69504638 AATTAGCTGGGCATGATGGCAGG + Intronic
932194230 2:69769247-69769269 TGATTGCTGGGAAAGCTGACTGG - Intronic
932299876 2:70658992-70659014 AATTAGCTGGGCAAGGTGGCGGG + Exonic
932358219 2:71084241-71084263 AATTAGCTGGGCATGATGGCGGG + Intergenic
932362969 2:71125133-71125155 AATTAGCTGGGTATGGTGACAGG - Intronic
932670104 2:73729661-73729683 AATTAGCTGGGCATGATGGCAGG - Intronic
932803829 2:74766284-74766306 ATTTAGCTGGGCATGGTGACAGG + Intergenic
932891074 2:75597983-75598005 AGGAGGCTGGGAAAGGTGACTGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933381474 2:81552094-81552116 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
933507886 2:83202236-83202258 AATTAGCTGGGCATGATGGCGGG - Intergenic
933659906 2:84919030-84919052 AATTAGCTGGGCATGATGGCAGG - Intergenic
933675873 2:85057026-85057048 AGTTAGCTGGGCATGGTGGCAGG + Exonic
934042614 2:88141279-88141301 AATTAGCTGGGCATGATGGCAGG - Intergenic
934068366 2:88361109-88361131 AATTAGCTGGGCATGGTGACAGG - Intergenic
934076502 2:88432909-88432931 AATTAGCTGGGCATGATGGCGGG + Intergenic
934305739 2:91820565-91820587 AGTTAACTGGAGAAGATGACCGG - Intergenic
934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG + Intergenic
934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG + Intergenic
934892606 2:98083904-98083926 AATTAGCTGGGCATGATGGCGGG - Intergenic
934967928 2:98739025-98739047 AATTAGCTGGGCATGATGGCAGG + Intergenic
935011119 2:99137144-99137166 AGTTAGCTGGGCATGGTGGCAGG - Intronic
935914913 2:107938606-107938628 AATTAGCTGGGCATGATGGCAGG + Intergenic
935954252 2:108359839-108359861 AATTAGCTGGGCATGATGGCAGG + Intergenic
936100804 2:109577442-109577464 AATTAGCTGGGCATGATGGCAGG + Intronic
936467795 2:112768922-112768944 AATTAGCTGGGAATGGTGGCAGG - Intergenic
936816176 2:116463835-116463857 AATTAGCTGGGCATGATGGCGGG - Intergenic
936919063 2:117669381-117669403 TGTTAGCTGGGAAAAATGCCTGG - Intergenic
937507837 2:122556946-122556968 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
937566444 2:123295380-123295402 AATTAGCTGGGCATGGTGACAGG + Intergenic
937599873 2:123718535-123718557 AATTAGCTGGGCATGGTGACAGG - Intergenic
937689249 2:124736079-124736101 AATTAGCTGGGCATGATGACGGG + Intronic
937755347 2:125530754-125530776 AATTAGCTGGGCATGATGGCGGG - Intergenic
937756375 2:125543617-125543639 AATTAGCTGGGCATGGTGACAGG + Intergenic
937815368 2:126244828-126244850 AGTTAGCTGGGAGGGAAGAGAGG + Intergenic
938055825 2:128214148-128214170 AATTAGCTGGGCATGATGGCAGG - Intergenic
938202128 2:129380865-129380887 AATTAGCTGGGCATGATGGCGGG + Intergenic
938256830 2:129865779-129865801 AATTAGCTGGGCATGGTGACAGG - Intergenic
938506433 2:131889056-131889078 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
938508168 2:131909017-131909039 AATTAGCTGGGCATGATGACAGG + Intergenic
938529060 2:132164437-132164459 AATTAGCTGGGCATGATGGCGGG - Intronic
938860837 2:135366870-135366892 AATTAGCTGGGCAAGGTGGCAGG + Intronic
938914751 2:135926037-135926059 AATTAGCTGGGCATGGTGACGGG - Intronic
938973895 2:136457478-136457500 TGGTGGCTGGGAATGATGACAGG + Intergenic
939021271 2:136960938-136960960 AATTAGCTGGGCAAGGTGGCGGG + Intronic
939216660 2:139247252-139247274 AATTAGCTGGGCATGGTGACGGG + Intergenic
939248686 2:139659442-139659464 AATTAGCTGGGCATGGTGACAGG - Intergenic
939686350 2:145205328-145205350 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
939857536 2:147378092-147378114 AATTAGCTGGGCATGATGGCGGG + Intergenic
940133665 2:150412172-150412194 AATTAGCTGGGCATGATGGCAGG + Intergenic
940813932 2:158277743-158277765 AATTAGCTGGGCATGATGGCGGG - Intronic
941824345 2:169876704-169876726 AATTAGCTGGGCATGATGGCAGG - Intronic
941930498 2:170934406-170934428 AATTAGCTGGGCGTGATGACAGG - Intronic
942103587 2:172610757-172610779 AATTAGCCGGGCATGATGACAGG - Intergenic
942212430 2:173684902-173684924 AGAAAGCTAGGCAAGATGACTGG + Intergenic
942296685 2:174524343-174524365 AATTAGCTGGGCATGATGGCGGG - Intergenic
942359948 2:175161907-175161929 AATTAGCTGGGCATGATGGCGGG - Intronic
942614103 2:177771851-177771873 AATTAGCTGGGCATGATGATGGG + Intronic
942655051 2:178206761-178206783 AATTAGCTGGGCATGATGGCAGG - Intronic
942655442 2:178210166-178210188 AGTTAGCTGGGCATGGTGGCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943096487 2:183435619-183435641 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
943364737 2:186958258-186958280 AGTTAGCTGGGCATGGTAACAGG + Intergenic
943789447 2:191915883-191915905 AATTAACTGGGAGAAATGACTGG - Intergenic
943818349 2:192284786-192284808 AATTAGCTGGGCATGATGGCAGG + Intergenic
944110382 2:196125422-196125444 AATTAGCTGGGCATGATGGCAGG - Intergenic
944204285 2:197141066-197141088 AATTAGCTGGGCATGATGGCAGG + Intronic
944208726 2:197184490-197184512 AATTAGCTGGGCATGATGGCGGG + Intronic
944643313 2:201750999-201751021 AGTTAGCCGGGCGTGATGACAGG - Intronic
944786314 2:203074474-203074496 AATTAGCTGGGTATGATGGCGGG - Intronic
944813172 2:203348090-203348112 AGTTAGCTGGGCATGATGGCGGG + Intronic
945120536 2:206452772-206452794 AGATAGCTGGGAAAACTGAGGGG - Intronic
945254940 2:207795636-207795658 AATTAGCTGGGCACGATGGCAGG - Intergenic
945260070 2:207835087-207835109 AATTAGCTGGGCATGGTGACGGG - Intronic
945268886 2:207918970-207918992 AGTAAGCAGAGAAAGAAGACAGG + Intronic
945379176 2:209119240-209119262 AATTAGCTGGGCATGATGGCGGG - Intergenic
945686522 2:212977483-212977505 AGTTAGGAGGGAAAGTTGATGGG - Intergenic
945748452 2:213748996-213749018 AGTTAGCTGGGCATGGTGGCGGG + Intronic
945901705 2:215545543-215545565 AATTAGCCGGGCAAGATGGCGGG + Intergenic
946002135 2:216491233-216491255 AATTAGCTGGGCATGGTGACGGG + Intergenic
946283389 2:218683421-218683443 AATTAGCTGGGCATGGTGACAGG - Intronic
946622870 2:221577423-221577445 AATTAGCTGGGCAAGGTGGCGGG + Intergenic
946847452 2:223871914-223871936 AATTAGCTGGGCATGATGACGGG - Intronic
947209122 2:227690556-227690578 AATTAGCTGGGCATGATGGCAGG + Intronic
947236577 2:227947799-227947821 AGTTAGCTGGGCGTGGTGACAGG + Intergenic
947253029 2:228129943-228129965 AGTTAGCTGGGCATGGTGGCAGG - Intronic
947502792 2:230683623-230683645 GGATAGCTGGGCAAGAGGACCGG - Intergenic
947622937 2:231602705-231602727 AATTAGCTGGGCATGATGGCCGG - Intergenic
947625931 2:231618748-231618770 AATTAGCTGGGCATGATGGCAGG + Intergenic
947982775 2:234424918-234424940 AATTAGCTGGGCATGATGGCAGG - Intergenic
948441431 2:237993134-237993156 AATTAGCTGGGCAAGGTGGCGGG - Intronic
1169009997 20:2242499-2242521 AATTAGCTGGGGATGGTGACAGG + Intergenic
1169086361 20:2826459-2826481 AGTTAGCTGGGCATGGTGATGGG - Intergenic
1169471758 20:5892175-5892197 AATTAGCTGGGCATGATGGCGGG - Intergenic
1169479820 20:5969441-5969463 AATTAGCTGGGCATGATGGCAGG + Intronic
1169956798 20:11112285-11112307 AATTAGCTGGGCATGATGACGGG + Intergenic
1170118673 20:12888655-12888677 AATTAGCTGGGCATGATGGCGGG + Intergenic
1170232808 20:14069095-14069117 AGTTAGCTGAGCACGATGGCGGG - Intronic
1170949455 20:20923717-20923739 AGTAAGCTGGGACAGCTGAGAGG + Intergenic
1171200785 20:23240394-23240416 AATTAGCTGGGCATGATGGCAGG - Intergenic
1171240981 20:23566733-23566755 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1171363604 20:24608325-24608347 AATTAGCTGGGCATGATGGCAGG - Intronic
1171908041 20:30916829-30916851 AATTAGCTGGGAATGGTGGCGGG - Intergenic
1171958822 20:31478981-31479003 AATTAGCTGGGCATGGTGACAGG - Intronic
1172003685 20:31802036-31802058 AATTAGCCGGGAATGATGGCGGG - Intergenic
1172009683 20:31839252-31839274 AATTAGCTGGGCATGGTGACGGG - Intergenic
1172075694 20:32295439-32295461 AATTAGCTGGGCATGATGGCGGG - Intronic
1172233686 20:33354653-33354675 AATTAGCTGGGTATGATGGCAGG + Intergenic
1172388941 20:34553038-34553060 AATTAGCTGGGCATGGTGACGGG + Intronic
1172404839 20:34680312-34680334 ATTTAGCTGGGCAAGGTGGCGGG + Intergenic
1172500748 20:35425122-35425144 AATTAGCTGGGCATGATGGCGGG + Intergenic
1172503610 20:35444741-35444763 AATTAGCTGGGCATGGTGACGGG - Intronic
1172565651 20:35928288-35928310 AATTAGCTGGGCATGGTGACAGG + Intronic
1172591655 20:36122202-36122224 ACTTATCTGAGAAACATGACAGG - Intronic
1172653003 20:36518069-36518091 AATTAGCTGGGCATGATGGCGGG + Intronic
1172719890 20:36991713-36991735 AGTTAGCCGGGCATGATGGCAGG + Intergenic
1172854912 20:37994280-37994302 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1172908172 20:38385079-38385101 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1173356749 20:42300107-42300129 AATTAGCTGGGCATGATGGCCGG + Intronic
1173503957 20:43572526-43572548 AATTAGCTGGGCACGGTGACGGG + Intronic
1173517534 20:43675460-43675482 AATTAGCTGGGCATGATGGCGGG - Intronic
1173604114 20:44317799-44317821 AATTAGCTGGGCATGGTGACGGG + Intergenic
1173647160 20:44640517-44640539 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1173765603 20:45606804-45606826 AGTTAGCTGGGTATGATGGTGGG - Intergenic
1173964942 20:47105474-47105496 AATTAGCTGGGCATGATGGCAGG + Intronic
1174311744 20:49661381-49661403 AATTAGCTGGGCATGATGGCAGG - Intronic
1174326578 20:49783821-49783843 AATTAGCTGGTCATGATGACGGG - Intergenic
1174340917 20:49894674-49894696 AATTAGCTGGGCATGGTGACGGG - Intergenic
1174428003 20:50447053-50447075 AGATATCTGGGAAAGCTGACTGG - Intergenic
1174647260 20:52096738-52096760 AATTAGCTGGGCAAGGTGGCAGG + Intronic
1175091629 20:56509462-56509484 AATTAGCTGGGCATGATGGCGGG + Intronic
1175101739 20:56584187-56584209 AATTAGCTGGGCAAGGTGGCGGG + Intergenic
1175173992 20:57099144-57099166 AATTAGCTGGGCATGATGGCAGG + Intergenic
1175360066 20:58402707-58402729 AGAAAGCTGAGAAAGATGCCAGG + Intronic
1175360145 20:58403430-58403452 AATTAGCTGTGATAGAAGACTGG - Intronic
1175425453 20:58862304-58862326 AGTTAGCTGGGCATGCTGGCAGG - Intronic
1175434847 20:58937730-58937752 AATTAGCTGGGCATGATGGCGGG - Intergenic
1175616033 20:60399087-60399109 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1175819889 20:61903394-61903416 AATTAGCTGGGCATGATGGCGGG + Intronic
1175848739 20:62075035-62075057 AGTTAGCTGGGCATGCTGGCGGG - Intergenic
1176371493 21:6064798-6064820 AATTAGCTGGGCATGATGGCGGG - Intergenic
1176686673 21:9854509-9854531 AATTAGCTGGGCACGATGGCGGG - Intergenic
1176767450 21:13035497-13035519 AATTAGCTGGGCATGATGGCGGG + Intergenic
1176855260 21:13963373-13963395 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1177164107 21:17580467-17580489 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1177202893 21:17977768-17977790 AGTTAGCTGGGCATGGTGGCCGG + Intronic
1177217698 21:18150933-18150955 AATTAGCTGGGCATGATGGCAGG + Intronic
1177717446 21:24857275-24857297 AATTAGCTGGGCATGATGGCAGG + Intergenic
1177729178 21:25006220-25006242 ATTTAGCTGGGCATGATGGCAGG - Intergenic
1177961792 21:27675963-27675985 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1177985806 21:27973326-27973348 AATTAGCTGGGCAAGGTGGCAGG - Intergenic
1178269716 21:31178453-31178475 AATTAGCTGGGCAAGGTGGCGGG - Intronic
1178316935 21:31574759-31574781 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1178325905 21:31645441-31645463 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1178337496 21:31756475-31756497 AATTAGCTGGGCATGATGGCGGG + Intergenic
1178444495 21:32626465-32626487 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1178495629 21:33083644-33083666 AATTAGCTGGGCATGATGGCAGG - Intergenic
1178542962 21:33470586-33470608 AATTAGCTGGGCATGATGGCAGG + Intronic
1178583005 21:33851545-33851567 AATTAGCTGGGCATGGTGACAGG - Intronic
1178908833 21:36657971-36657993 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1178972143 21:37189694-37189716 AGTTAGCTGGGAGTGGTGGCGGG - Intronic
1178988059 21:37325633-37325655 AATTAGCCGGGCATGATGACGGG + Intergenic
1179064485 21:38011735-38011757 AATTAGCTGGGCATGATGGCAGG - Intronic
1179109819 21:38437034-38437056 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1179588685 21:42390577-42390599 AATTAGCTGGGCATGATGGCAGG + Intronic
1179646705 21:42780428-42780450 AATTAGCTGGGCATGATGGCAGG + Intergenic
1179647213 21:42783398-42783420 AATTAGCTGGGCATGATGGCAGG - Intergenic
1179666189 21:42914135-42914157 AATTAGCTGGGCATGATGGCGGG + Intergenic
1179707225 21:43188569-43188591 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1179752026 21:43473741-43473763 AATTAGCTGGGCATGATGGCGGG + Intergenic
1179792509 21:43763732-43763754 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1180196447 21:46197738-46197760 AATTAGCTGGGCATGATGACAGG + Intronic
1180279825 22:10683393-10683415 AGTTAACTGGAGAACATGACCGG + Intergenic
1180285185 22:10738957-10738979 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1180308491 22:11149526-11149548 AATTAGCTGGGCATGATGGCAGG - Intergenic
1180341476 22:11622994-11623016 AATTAGCTGGGAATGGTGGCGGG - Intergenic
1180366876 22:11947992-11948014 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1180432015 22:15261797-15261819 AATTAGCTGGGCATGATGGCAGG + Intergenic
1180520961 22:16203577-16203599 AATTAGCTGGGCATGGTGACGGG + Intergenic
1180521350 22:16209208-16209230 AATTAGCTGGGCATGGTGACAGG + Intergenic
1180546968 22:16511339-16511361 AATTAGCTGGGCATGATGGCAGG - Intergenic
1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG + Intergenic
1180683926 22:17650017-17650039 AATTAGCTGGGCATGATGGCAGG - Intronic
1180689270 22:17697962-17697984 AATTAGCTGGGCAAGGTGGCAGG - Intronic
1180943699 22:19677923-19677945 AATTAGCTGGGCATGGTGACGGG + Intergenic
1181087415 22:20447689-20447711 AGTTAGCTGGGTATGGTGGCGGG - Intronic
1181098778 22:20524768-20524790 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1181443881 22:22953465-22953487 AATTAGCTGGGCATGATGGCGGG + Intergenic
1181554699 22:23662067-23662089 AGTTATCTGGGCATGATGGCGGG + Intergenic
1181727425 22:24821183-24821205 AATTAGCTGGGCATGATGGCGGG - Intronic
1181861500 22:25822805-25822827 AGCAAGCTGGGAAACGTGACTGG + Intronic
1182380215 22:29881802-29881824 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1182384183 22:29922173-29922195 AATTAGCTGGGCAAGGTGGCGGG - Intronic
1182596003 22:31421066-31421088 AGTTAGCTGGGTGCGATGGCAGG - Intronic
1182637685 22:31741721-31741743 AATTAGCTGGGCATGATGGCAGG + Intronic
1182889538 22:33805583-33805605 AATTAGCTGGGCATGATGGCAGG + Intronic
1182892046 22:33827219-33827241 AATTAGCTGGGCATGATGGCAGG + Intronic
1183090094 22:35516364-35516386 AATTAGCTGGGCATGATGGCAGG - Intergenic
1183103056 22:35595657-35595679 AATTAGCTGGGCATGATGGCAGG - Intergenic
1183525533 22:38320210-38320232 AATTAGCTGGGCACGATGGCGGG + Intronic
1183527535 22:38332619-38332641 AATTAGCTGGGCATGATGGCTGG + Intronic
1184041096 22:41944285-41944307 AATTAGCTGGGCATGATGGCGGG + Intronic
1184126986 22:42494266-42494288 AATTAGCTGGGCATGATGGCGGG + Intergenic
1184476665 22:44725811-44725833 AATTAGCTGGGCAAGATGGTGGG - Intronic
1184750901 22:46486084-46486106 AATTAGCTGGGCAAGGTGGCGGG - Intronic
1184756765 22:46520607-46520629 AATTAGCTGGGCCTGATGACGGG - Intronic
1184845250 22:47079233-47079255 AGTTAGCTGGGCATGCTGGCAGG - Intronic
1185358327 22:50388721-50388743 AGTTAGCTGGGTATGGTGGCAGG + Intronic
1185390678 22:50559777-50559799 AATTAGCTGGGCATGGTGACGGG + Intronic
949250655 3:1979626-1979648 AATTAGCTGGGTATGATGGCAGG + Intergenic
949531438 3:4959704-4959726 AATTAGCTGGGCATGATGGCAGG + Intergenic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
949777438 3:7648498-7648520 AGTTAGCTGGGCATGGTGGCAGG + Intronic
950577873 3:13843893-13843915 AGTTAGCTGGACAAGGTGGCGGG - Intronic
950985920 3:17366140-17366162 AATTAGCTGGGCATGGTGACAGG + Intronic
951430382 3:22599973-22599995 AATTAGCTGGGCATGATGGCAGG - Intergenic
951730727 3:25807814-25807836 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
951920909 3:27853140-27853162 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
952174444 3:30846529-30846551 AGTTAGCTGGTAGAGAGAACGGG + Intronic
952348256 3:32509081-32509103 AATTAGCTGGGAATAATGGCAGG + Intergenic
952403551 3:32985437-32985459 AATTAGCTGGGAGTGGTGACAGG - Intergenic
952465310 3:33578598-33578620 AGTTAGCCCCGAAAGGTGACTGG + Intronic
953162816 3:40437124-40437146 AATTAGCTGGGCAGGATGGCAGG + Intergenic
953275988 3:41498742-41498764 AATTAGCTGGGCATGATGGCGGG - Intronic
953326512 3:42015886-42015908 AATTAGCTGGGCATGATGATGGG + Intronic
953414933 3:42710250-42710272 AATTAGCTGGGCATGGTGACAGG - Intronic
953580086 3:44145865-44145887 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
953742602 3:45550342-45550364 AGTAAGCTGGGAAACAGCACAGG + Intergenic
953799379 3:46010404-46010426 AATTAGCTGGGAATGGTGGCGGG + Intergenic
953895595 3:46797089-46797111 AATTAGCTGGGCATGATGGCAGG + Intronic
953997723 3:47533277-47533299 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
954119882 3:48491265-48491287 AATTAGCTGGGCATGGTGACGGG - Intronic
954236812 3:49263363-49263385 AGTTAGCTGGGTGTGGTGACGGG - Intergenic
954246448 3:49336010-49336032 AATTAGCTGGGAGTGGTGACAGG - Intronic
954344223 3:49982858-49982880 AATTAGCTGGGCACGATGGCAGG - Intronic
954389703 3:50262144-50262166 AATTAGCTGGGCATGATGACGGG + Intergenic
954546407 3:51439588-51439610 AATTAGCTGGGCATGATGGCAGG - Intronic
954623846 3:52011571-52011593 AATTAGCTGGGAATGGTGGCAGG - Intergenic
955063197 3:55512035-55512057 AGCTATCTGGGAAATATGGCAGG + Intronic
955321996 3:57981188-57981210 AATTAGCTGGGAGCGATGTCAGG + Intergenic
956281685 3:67563810-67563832 AATTAGCTGGGAGTGATGGCAGG + Intronic
956423290 3:69107623-69107645 AATTAGCTGGGCATGATGGCAGG - Exonic
956463405 3:69494741-69494763 AGTTAGCTGGGCATGGTGGCGGG + Intronic
956535538 3:70271910-70271932 AATTAGCTGGGCATGATGGCAGG - Intergenic
956648099 3:71476637-71476659 AATTAGCTGGGCATGATGGCGGG - Intronic
956679035 3:71760899-71760921 AATTAGCTGGGCATAATGACAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
956718478 3:72098664-72098686 AGGGAGCAGGGAAAGAGGACAGG - Intergenic
956845599 3:73179526-73179548 AATTAGCTGGGCAAGGTGGCAGG - Intergenic
957131061 3:76222901-76222923 AGTTAGCTGGGCATGGTGGCAGG - Intronic
957416252 3:79909318-79909340 GGTAAGCTGGTAAAGATGCCTGG + Intergenic
957456626 3:80459867-80459889 AGTTAGGTGGGAAACATAATTGG - Intergenic
957684324 3:83481265-83481287 AATTAGCTGGGAATGGTGACAGG + Intergenic
958142872 3:89586062-89586084 AGGTGGCTGGTAAAGAGGACAGG + Intergenic
958575566 3:95946455-95946477 AATTAGCCGGGCATGATGACAGG - Intergenic
958601892 3:96305312-96305334 AATTAGCTGGGCATGGTGACGGG - Intergenic
958955418 3:100460874-100460896 AATTAGCTGGGCATGGTGACCGG - Intergenic
959048344 3:101499515-101499537 AATTAGCTGGGCATGATGGCAGG - Intronic
959206204 3:103310308-103310330 AATTAGCTGGGCATGATGGCGGG + Intergenic
959331647 3:105013395-105013417 AATTAGCTGGGCATGGTGACAGG - Intergenic
959465377 3:106680188-106680210 ACTTAGCTGGGCATGATGGCGGG - Intergenic
959487323 3:106941806-106941828 AATTAGCTGGGCATGGTGACGGG + Intergenic
959878668 3:111417428-111417450 AGTTCACTGGGTAAGATGGCTGG - Intronic
960327615 3:116316620-116316642 AATTAGCTGGGCAGGATGGCGGG + Intronic
960610117 3:119548127-119548149 AATTAGCTGGGCATGATGGCGGG - Intronic
960794329 3:121469036-121469058 AATTAGCTGGGCATGATGGCGGG + Intronic
961134288 3:124495587-124495609 AATTAGCTGGGCATGATGGCAGG + Intronic
961172349 3:124806580-124806602 AATTAGCTGGGAGTGATGGCGGG - Intronic
961481155 3:127181787-127181809 AATTAGCTGGGGATGATGGCAGG + Intergenic
961766608 3:129216556-129216578 AATTAGCTGGGCATGGTGACGGG + Intergenic
961985685 3:131130948-131130970 AGTTAGCTGGGCATGGTGGCAGG - Intronic
962223682 3:133586242-133586264 ACTTAGCTGGGCATGATGGCAGG - Intronic
962280820 3:134050409-134050431 AATTAGCTGGGCATGGTGACAGG + Intronic
962587089 3:136852639-136852661 AATTAGCTGGGAATGGTGGCAGG - Intronic
962794581 3:138839238-138839260 AATTAGCTGGGCATGATGGCAGG + Intergenic
963366213 3:144337852-144337874 AATTAGCTGGGCATGGTGACAGG - Intergenic
963701132 3:148628096-148628118 AATTAGCTGGGCACGATGGCAGG - Intergenic
963745925 3:149125109-149125131 AATTAGCTGGGCATGATGGCAGG + Intergenic
964070120 3:152621383-152621405 AGTGATCTGGGACAGAAGACAGG + Intergenic
964378426 3:156072658-156072680 AATTAACTGGGAAAGTTGATGGG + Intronic
964456656 3:156875844-156875866 AATTAGCTGGGTAAGGTGGCGGG + Intronic
965184870 3:165449931-165449953 AGTTGGCAGGTAATGATGACTGG - Intergenic
965211163 3:165791144-165791166 AATTAGCTGGGAGTGATGGCGGG + Intronic
965431944 3:168599797-168599819 AATTAGCTGGGCATGGTGACAGG + Intergenic
965531696 3:169776850-169776872 AATTAGCTGGGCATGATGGCGGG - Intronic
965535914 3:169823494-169823516 AATTAGCTGGGCATGATGGCAGG - Intronic
965767818 3:172149965-172149987 AATTAGCTGGGCACGGTGACGGG - Intronic
966162963 3:176987107-176987129 AATTAGCCGGGCATGATGACAGG + Intergenic
966190276 3:177266181-177266203 AATTAGCTGGGAGAGGTGGCGGG + Intergenic
966327867 3:178777284-178777306 AATTAGCTGGGTGTGATGACGGG + Intronic
966692937 3:182760313-182760335 AATTAGCTGGGCATGGTGACAGG - Intergenic
966712979 3:182988452-182988474 AATTAGCTGGGTGAGATGGCAGG + Intergenic
966718112 3:183034300-183034322 AATTAGCTGGGCATGGTGACGGG + Intronic
966838710 3:184070058-184070080 AATTAGCTGGGCATGATGGCGGG - Intergenic
966932028 3:184681550-184681572 AATTAGCTGGGCATGATGGCAGG + Intronic
967162218 3:186748861-186748883 AATTAGCTGGGCATGATGGCGGG + Intergenic
967189477 3:186973182-186973204 AATTAGCTGGGCATGATGGCGGG - Intronic
967585293 3:191206522-191206544 ATTTAGCTAGGAAAACTGACTGG - Intronic
967776270 3:193389200-193389222 AATTAGCTGGGCATGGTGACAGG + Intergenic
967901253 3:194454678-194454700 AGTTAGCTGGGCATGGTGGCAGG + Intronic
968198305 3:196729182-196729204 AATTAGCTGGGAGAGGTGGCGGG + Intronic
968210798 3:196847161-196847183 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
968636004 4:1679898-1679920 ATTTAGCTGGGCATGATGGCAGG + Intronic
968665174 4:1817095-1817117 AATTAGCTGGGCATGATGGCAGG + Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
969035435 4:4249640-4249662 AGTTAGCCGGGAATGGTGGCCGG + Intergenic
969166060 4:5314519-5314541 AGTTAGCTGGGCATGGTGACAGG + Intronic
969406788 4:6998685-6998707 AATTAGCTGGGCATGATGGCAGG - Intronic
970185114 4:13444174-13444196 AGTTAGCTGGGCATGGTGGCGGG - Intronic
970272561 4:14362920-14362942 AATTAGCTGGGCATGATGGCGGG - Intergenic
970323142 4:14895312-14895334 AGTTGGCTGGGAAGGAAGACAGG - Intergenic
970507282 4:16744303-16744325 AATTAGCTGGGCATGATGGCGGG - Intronic
971171169 4:24234512-24234534 AATTAGATGGGAAGGAAGACAGG + Intergenic
971275429 4:25192122-25192144 AATTAGCTGGGCATGGTGACTGG - Intronic
971334295 4:25708385-25708407 AGTTAGCTGGGCATGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972306753 4:37838027-37838049 AATTAGCTGGGAGTGATGGCAGG - Intronic
972456220 4:39258299-39258321 AATTAGCTGGGCAAGGTGGCAGG - Intronic
972474909 4:39441002-39441024 AATTAGCTGGGCATGGTGACAGG - Intronic
972494568 4:39622230-39622252 AATTAGCTGGGCACGATGGCGGG - Intronic
972499312 4:39662656-39662678 AATTAGCTGGGCATGATGGCGGG - Intergenic
973575687 4:52286577-52286599 AATTAGCTGGGCATGATGGCAGG + Intergenic
973792590 4:54392019-54392041 ACTTAGCTGGGCATGATGGCGGG + Intergenic
973890105 4:55360064-55360086 AGTTAGCTGGGCATGGTGGCGGG + Intronic
974279119 4:59767961-59767983 AATTAGCTGGGCATGATGGCAGG - Intergenic
974476335 4:62387026-62387048 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
974706484 4:65523485-65523507 AGTTAGCTGGTACAAAAGACAGG + Intronic
974856689 4:67469492-67469514 AGTTAGCCGGGCATGATGGCAGG - Intergenic
975137141 4:70886148-70886170 AATTAGCTGGGCATGGTGACTGG - Intergenic
975561381 4:75711168-75711190 AATTAGCTGGGCATGATGGCGGG + Intronic
975574419 4:75848606-75848628 AGTTAGCTGGGCACGGTGACAGG - Intergenic
976013303 4:80518692-80518714 GGTGAGCAGGGAAAGATAACAGG + Intronic
976076085 4:81300621-81300643 AATTAGCTGGGCATGATGGCAGG - Intergenic
976480961 4:85544808-85544830 AATTATCTGAGAAAGATGAAAGG - Intronic
976645084 4:87379104-87379126 AATTAGCTGGGCATGATGGCAGG - Intronic
976999863 4:91483582-91483604 AATTAGCTGGGAATGGTGGCAGG - Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977315907 4:95447647-95447669 AGTTAGCTGGGCGTGGTGACAGG - Intronic
978450933 4:108832850-108832872 AATTAGCTGGGCATGGTGACGGG + Intronic
978523157 4:109637276-109637298 AGGGAGCAGGGAAAGATGACTGG + Intronic
978532977 4:109732706-109732728 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
978602942 4:110447803-110447825 AATTAGCTGGGCATGGTGACAGG - Intronic
978678230 4:111344745-111344767 AATTAGCTGGGAGTGGTGACGGG + Intergenic
978985382 4:115005736-115005758 AGTTAGCTGGATAAGATGGTGGG + Intronic
979107577 4:116706746-116706768 AATTAGCTGGGTATGATGGCAGG - Intergenic
979278311 4:118836942-118836964 ATTTAGCAGTGAAAGATGATAGG - Intronic
979410677 4:120375092-120375114 AGTTAGTTGGGGGACATGACGGG + Intergenic
979437595 4:120712135-120712157 AGTTAGCTGGGCATGGTGGCGGG + Intronic
979471552 4:121104225-121104247 AATTAGCTGGGAGTGATGGCAGG - Intergenic
979513016 4:121575409-121575431 AATTAGCTGGGCATGATGGCAGG + Intergenic
979575218 4:122282491-122282513 AATTAGCTGGGCATGATGGCAGG + Intronic
979731171 4:124024213-124024235 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
980066923 4:128199935-128199957 AGTTAGCTGGGTGTGATGGCAGG + Intronic
980258202 4:130410129-130410151 AATTAGCTGGGCATGGTGACAGG + Intergenic
980870241 4:138603124-138603146 AATTAGCTGGGCATGGTGACAGG - Intergenic
980932971 4:139199018-139199040 AATTAGCTGGGCATGGTGACAGG + Intergenic
981097037 4:140792603-140792625 AATTAGCTGGGCATGATGGCAGG + Intergenic
982041250 4:151399140-151399162 AATTAGCTGGGCAAGGTGGCGGG + Intergenic
982103343 4:151990199-151990221 AATTATCTCGGAAAGATGAATGG + Intergenic
982241677 4:153305984-153306006 AATTAGCTGGGCATGGTGACGGG + Intronic
982328827 4:154158624-154158646 GGTAAGCTTGAAAAGATGACTGG + Intergenic
982608728 4:157546767-157546789 AGTTAGCTGAGCATGATGGCAGG + Intergenic
982764803 4:159333523-159333545 AGTTGACTGGGAAAAATGAAAGG - Intronic
982966762 4:161918790-161918812 AATTAGCTGGGCATGATGGCGGG - Intronic
983069041 4:163247647-163247669 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
983378205 4:166957104-166957126 AGTTAGCTAGGCAAGGTGGCAGG + Intronic
983700444 4:170586467-170586489 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
984010115 4:174360464-174360486 AATTAGCTGGGCATGGTGACAGG + Intergenic
984167932 4:176325202-176325224 AATTAGCTGGGAATGGTGGCAGG - Intronic
984225253 4:177027143-177027165 AGTCAACTGGCTAAGATGACAGG - Intergenic
984378298 4:178959614-178959636 AATTAGCTGGGCATGGTGACAGG - Intergenic
984394852 4:179183874-179183896 ATTTAGCTGGGAGAGATGGCAGG + Intergenic
984544212 4:181079752-181079774 AATTAGCTAGGAATGATGGCGGG - Intergenic
984712762 4:182899547-182899569 AATTAGCTGGGCATGGTGACGGG - Intronic
984853413 4:184173050-184173072 AATTAGCTGGGCATGGTGACGGG - Intronic
985046928 4:185950101-185950123 AATTAGCTGGGCATGGTGACAGG + Intronic
985210224 4:187585143-187585165 AATTAGCTGGGCAAGGTGGCGGG - Intergenic
985214399 4:187635365-187635387 AATTAGCTGGGCACGATGGCGGG + Intergenic
985245781 4:187978487-187978509 TGTTATCTGGGAAAGAAGAAAGG - Intergenic
985301689 4:188496813-188496835 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
985614040 5:908807-908829 AATTAGCTGGGCATGATGGCGGG + Intronic
985756059 5:1718236-1718258 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
986521376 5:8621866-8621888 AATTAGCTGGGCATGGTGACAGG + Intergenic
986870998 5:12046790-12046812 ATTTAGCCGGGAATGATGGCGGG - Intergenic
987202475 5:15591278-15591300 AGTTAGCTGGGCATGGTGGCGGG + Intronic
987214086 5:15714698-15714720 AATTAGCTGGGAATGGTGGCGGG + Intronic
987310582 5:16677907-16677929 AGTTAGCTGGGCATGGTGGCAGG - Intronic
987391175 5:17376945-17376967 AATTAGCTGGGCATGATGATGGG - Intergenic
987590570 5:19920660-19920682 AATTAGCTGGGCATGATGGCGGG - Intronic
987670542 5:21001892-21001914 AATTAGCTGGGCGAGATGGCGGG - Intergenic
987804218 5:22742030-22742052 AGGTAGCTGGGCATGATGGCAGG + Intronic
987970167 5:24932333-24932355 AGTTAGCTGGGAGTGATGGTGGG + Intergenic
988271264 5:29020748-29020770 AGAAAGCAGGGAAAGAGGACTGG - Intergenic
988423195 5:31031151-31031173 AATTAGCTGGGCATGGTGACAGG - Intergenic
988481585 5:31636015-31636037 AGTTAGCTGGGCATGATAGCGGG - Intergenic
988558293 5:32257618-32257640 AGTTAGCTGGGCATGGTGGCGGG + Intronic
988577422 5:32441120-32441142 AGTTAGCTGGGCATGGTGGCGGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
988777416 5:34489979-34490001 AATTAGCTGGGCATGATGGCGGG + Intergenic
988969941 5:36457064-36457086 AATTAGCTGGGCATGATGGCGGG + Intergenic
989151292 5:38302086-38302108 AATTAGCTGGGCATGGTGACGGG + Intronic
989190301 5:38664238-38664260 AATTAGCTGGGCATGATGGCGGG - Intergenic
989213716 5:38882424-38882446 AATTAGCTGGGCATGGTGACGGG + Intronic
989328777 5:40230585-40230607 AGTTAGCTGGGCATAGTGACAGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
989641718 5:43589337-43589359 AGGTAGCTGATAGAGATGACTGG + Intergenic
989761329 5:45020103-45020125 AATTAGCTGGGCATGATGATGGG + Intergenic
990298594 5:54427960-54427982 AATTAGCTGGGCATGATGTCAGG + Intergenic
990477102 5:56171968-56171990 AATTAGCTGGGAATGGTGGCGGG + Intronic
990505393 5:56439131-56439153 AATTAGCTGGGCATGATGGCAGG - Intergenic
990813669 5:59757662-59757684 AGCCAGCTGGGAATGATGGCCGG - Intronic
991240926 5:64459006-64459028 AGTCACCTGGGAAGGATCACTGG - Intergenic
991258470 5:64641298-64641320 AATTAGCTGGGCATGGTGACAGG + Intergenic
991281534 5:64920112-64920134 AATTAGCTGGGCATGATGGCGGG - Intronic
991352174 5:65730703-65730725 AATTAGCTGGGCATGATGGCGGG - Intronic
991661131 5:68951824-68951846 AATTAGCTGGGCATGATGGCGGG + Intergenic
991671846 5:69055752-69055774 AATTAGCTGGGCATGATGGCAGG + Intergenic
991699219 5:69301585-69301607 TATTAGCTGGGAATGATGGCAGG + Intronic
991863758 5:71037821-71037843 AATTAGCTGGGCATGATGGCAGG + Intronic
992077286 5:73203150-73203172 AATTAGCTGGGCATGGTGACGGG + Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992276729 5:75128650-75128672 AATTAGCTGGGAATGATGGCAGG - Intronic
992664929 5:78998699-78998721 AATTAGCTGGGCATGATGGCGGG + Intronic
992709835 5:79441009-79441031 AATTAGCTGGGCATGATGGCAGG + Intronic
992844846 5:80736075-80736097 AATTAGCTGGGCATGATGGCGGG + Intronic
992965983 5:82000803-82000825 AATTAGCTGGGCATGATGGCAGG - Intronic
993190431 5:84673193-84673215 AGTTAGCTGGGCATGGTGATGGG - Intergenic
993687040 5:90950468-90950490 AATTAGCTGGGCATGGTGACGGG - Intronic
993783424 5:92097928-92097950 AGGTTTCTGGGAAAGAGGACTGG + Intergenic
993806549 5:92417643-92417665 AATTAGCTGGGCATGATGGCGGG - Intergenic
993929329 5:93918568-93918590 AATTAGCTGGGCATGATGGCGGG - Intronic
994093274 5:95826848-95826870 AATTAGCTGGGCATGGTGACAGG + Intergenic
994101972 5:95903365-95903387 AATTAGCTGGGCATGGTGACAGG - Intronic
994595958 5:101835208-101835230 AGTTAGCTGGGCATGATGGCAGG + Intergenic
994759286 5:103833387-103833409 AATTAGCTGGGCATGGTGACGGG - Intergenic
994901857 5:105783102-105783124 AATTAGCTGGGCATGATGGCGGG + Intergenic
994975334 5:106797086-106797108 AATTAGCTGGGGATGGTGACAGG + Intergenic
995322716 5:110855325-110855347 AATTAGCCGGGTATGATGACAGG - Intergenic
995331696 5:110954172-110954194 AGTTAGCTGGGTATGGTGGCAGG + Intergenic
995520514 5:112999910-112999932 AATTAGCTGGGCATGGTGACAGG + Intronic
996316660 5:122168191-122168213 AATTAGCTGGGCATGATGGCAGG - Intronic
996434351 5:123418379-123418401 AGTTAGCTTGGGAAATTGACAGG - Exonic
996565977 5:124880285-124880307 AATTAGCTGGGAATGGTGGCGGG - Intergenic
996718370 5:126606016-126606038 AGTTATCTGGGAATGAGAACAGG - Intronic
996883217 5:128324764-128324786 AGTTAGCCGGGCATGATGCCGGG - Intronic
996945236 5:129058768-129058790 AATTAGCTGGGCATGGTGACGGG + Intergenic
997458004 5:134031800-134031822 AATTAGCTGGGAATGGTGGCAGG + Intergenic
997460922 5:134051845-134051867 AATTAGCTGGGCATGATGACAGG - Intergenic
997511433 5:134457522-134457544 AGTTAGCTGGGCATGATGGCGGG + Intergenic
997517194 5:134498713-134498735 AATTAGCTGGGCATGATGGCGGG + Intergenic
997569423 5:134914818-134914840 AATTAGCTGGGCATGATGGCGGG - Intronic
997839301 5:137224472-137224494 TGTTAGCTGGGAAAGGAAACGGG + Intronic
997957875 5:138294338-138294360 AGTTAGCTGGGCATGGTGGCAGG - Intronic
998144473 5:139719006-139719028 AATTAGCTGGGCATGATGGCAGG - Intergenic
998152872 5:139767139-139767161 AATTAGCTGGGCAAGGTGGCGGG - Intergenic
998167129 5:139850614-139850636 GGTGAGCAGGGAAAGATGAGTGG - Intronic
998182652 5:139956224-139956246 AGTGTGTTGGGAAAGGTGACTGG - Intronic
998259034 5:140614045-140614067 AATTAGCTGGGCATGGTGACGGG - Intergenic
998324122 5:141263787-141263809 AATTAGCTGGGCATGATGGCGGG + Intergenic
998343358 5:141438808-141438830 AATTAGCTGGGCATGGTGACAGG - Intronic
998669731 5:144340251-144340273 AATTAGCTGGGCATGGTGACGGG + Intronic
998674439 5:144391107-144391129 AGTTAGCTGGGAATGGAGTCAGG - Intronic
998765469 5:145482092-145482114 AGTTATGTGATAAAGATGACAGG - Intronic
999106208 5:149073444-149073466 ACTCACCTGGGAAAGCTGACTGG + Intergenic
999145574 5:149391113-149391135 AATTAGCTGGGGATGATGGCAGG - Intronic
999210124 5:149880912-149880934 ATTTAGCTGGGAATGGTGGCGGG + Intronic
999388297 5:151171330-151171352 AATTAGCTGGGCGAGATGGCGGG + Intergenic
999787493 5:154905043-154905065 AGTTAGCTGGGCATGGTGGCGGG + Intronic
999869403 5:155733394-155733416 AGTTTGCTGGACAAGATGTCTGG - Intergenic
999990577 5:157046366-157046388 AGTTAGCTGGGAAAGATGACAGG + Intronic
1000045586 5:157519431-157519453 AATTAGCTGGGCATGATGGCTGG - Intronic
1000337072 5:160249612-160249634 AATTAGCTGGGTATGGTGACAGG + Intergenic
1000428164 5:161116924-161116946 AATTAGCTGGGTATGATGGCTGG - Intergenic
1000693600 5:164352523-164352545 AATTAGCTGGGCAGGATGATGGG + Intergenic
1000879150 5:166677249-166677271 ATTTAGCTGGGCACGATGGCAGG - Intergenic
1000940639 5:167356031-167356053 AATTAGCTGGGCATGATGGCGGG + Intronic
1001027929 5:168239823-168239845 AGTTACCTGGGAAAGACCAATGG - Intronic
1001113998 5:168923663-168923685 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1001164768 5:169354074-169354096 AATTAGCTGGGCATGATGGCAGG + Intergenic
1001281989 5:170392672-170392694 AATTAGCTGGGCACGATGGCAGG + Intronic
1001478482 5:172068190-172068212 AATTAGCTGGGTATGGTGACAGG + Intronic
1001631151 5:173176579-173176601 AATTAGCTGGGCATGATGGCAGG - Intergenic
1001707064 5:173749181-173749203 AATTAGCTGGGCATGATGGCGGG + Intergenic
1001908837 5:175497036-175497058 AATTAGCTGGGCATGATGGCAGG - Intronic
1001908922 5:175497779-175497801 AGTTAGCTGGGTGAGGTGGCGGG + Intronic
1001987742 5:176089952-176089974 AATTAGCTGGGCATGCTGACCGG + Intronic
1002032124 5:176438026-176438048 AGTTAGCTGGGCATGATGACAGG + Intergenic
1002119806 5:176993857-176993879 AATTAGCTGGGAATGGTGGCAGG + Intronic
1002130253 5:177076890-177076912 AATTAGCTGGGCATGGTGACAGG + Intronic
1002229125 5:177748188-177748210 AATTAGCTGGGCATGCTGACCGG - Intronic
1002266218 5:178035585-178035607 AATTAGCTGGGCATGCTGACCGG + Intronic
1002290245 5:178195454-178195476 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1002387511 5:178879526-178879548 AATTAGCTGGGCATGATGGCGGG - Intronic
1002414032 5:179109152-179109174 AATTAGCTGGGCATGATGGCGGG + Intergenic
1002505177 5:179674409-179674431 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1002515215 5:179752920-179752942 AATTAGCTGGGCATGATGGCGGG - Intronic
1002577493 5:180182989-180183011 TGTTATCTGGCAAAGATGAAGGG + Intronic
1002647454 5:180667337-180667359 AATTAGCTGGGCATGATGGCAGG - Intergenic
1003275477 6:4647113-4647135 AATTAGCTGGGCATGATGGCGGG + Intergenic
1003410723 6:5860174-5860196 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1003463151 6:6351213-6351235 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1003521277 6:6860740-6860762 AATTAGCTGGGCATGGTGACGGG + Intergenic
1003587698 6:7408183-7408205 AATTAGCTGGGCATGATGGCAGG - Intronic
1003657031 6:8021448-8021470 AATTAGCTGGGCATGATGGCGGG + Intronic
1003777695 6:9387496-9387518 AATTAGCTGGGCAAGGTGGCAGG - Intergenic
1003851855 6:10231937-10231959 AATTAGCTGGGAATGGTGGCTGG + Intergenic
1004261050 6:14108155-14108177 AATTAGCTGGGCATGATGGCAGG + Intergenic
1004274246 6:14221588-14221610 AATTAGCTGGGCATGGTGACGGG - Intergenic
1004352312 6:14900926-14900948 AATTAGCTGGGCAAGGTGGCGGG + Intergenic
1004464877 6:15875477-15875499 AATTAGCTGGGCATGGTGACGGG + Intergenic
1005232344 6:23717015-23717037 AATTAGCTGGGCATGATGGCAGG - Intergenic
1005607558 6:27489819-27489841 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1005895468 6:30173549-30173571 AATTAGCTGGGCGAGATGGCAGG + Intergenic
1005921047 6:30402047-30402069 AATTAGCTGGGCGTGATGACAGG + Intergenic
1005942240 6:30569232-30569254 AGTTAGCTGGGCGAGGTGGCGGG - Intergenic
1006005177 6:30996320-30996342 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1006078958 6:31553180-31553202 AATTAGCTGGGCATGATGGCAGG - Intronic
1006315021 6:33285990-33286012 AATTAGCTGGGCATGATGGCAGG + Intronic
1006417545 6:33913546-33913568 AGTTAGCTAGGAAAGAAAATGGG - Intergenic
1006546319 6:34784881-34784903 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1006852838 6:37111664-37111686 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1006863699 6:37191299-37191321 AATTAGCTGGGCATGATGGCGGG + Intergenic
1007029274 6:38613471-38613493 AATTAGCTGGGCATGATGGCGGG + Intronic
1007121989 6:39389880-39389902 AATTAGCTGGGCATGGTGACGGG + Intronic
1007186575 6:39977074-39977096 AATTAGCTGGGCATGATGGCGGG - Intergenic
1007310541 6:40942346-40942368 AATTAGCTGGGCATGGTGACGGG + Intergenic
1007404639 6:41627511-41627533 AGTTAGCCGGGCATGATGGCGGG - Intergenic
1007556827 6:42773225-42773247 AATTAGCTGGGCATGATGGCGGG - Intronic
1007591537 6:43024003-43024025 AATTAGCTGGGCATGATGGCAGG - Intronic
1007883393 6:45193565-45193587 AATTAGCTGGGCATGGTGACGGG + Intronic
1008069158 6:47082022-47082044 AATTAGCTGGGCATGATGGCAGG - Intergenic
1008106030 6:47442085-47442107 AATTAGCTGGGCATGATGGCAGG - Intergenic
1008755843 6:54794882-54794904 AATTAGCTGGGCATGGTGACAGG + Intergenic
1008846893 6:55977353-55977375 AGTTAGCTGGGCATGGTGGCTGG + Intergenic
1009291508 6:61888708-61888730 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1009347543 6:62634511-62634533 AGTTAGCTGGGTGTGGTGACGGG + Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009401747 6:63264226-63264248 AATTAGCTGGGCATGATGGCAGG + Intergenic
1009416342 6:63420052-63420074 AATTAGCTGGGCATGATGGCAGG + Intergenic
1010044787 6:71429021-71429043 AATTAGCTGGGCACGATGGCAGG - Intergenic
1010206531 6:73327342-73327364 AATTAGCTGGGCAAGATGGTGGG + Intergenic
1010227604 6:73505700-73505722 AATTAGCTGGGCATGATGGCAGG - Intronic
1010554475 6:77262102-77262124 AATTAGCTGGGCATAATGACAGG - Intergenic
1011285043 6:85714367-85714389 AATTAGCTGGGAGTGGTGACGGG - Intergenic
1011343033 6:86338825-86338847 AATTAGCTGGGCATGATGGCAGG + Intergenic
1011528513 6:88294064-88294086 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1011715659 6:90102639-90102661 AATTAGCTGGGCATGATGGCGGG + Intronic
1013105620 6:107024394-107024416 AATTAGCTGGGCATGGTGACGGG + Intergenic
1013161442 6:107549116-107549138 AATTAGCTGGGCATGATGGCAGG + Intronic
1013363450 6:109416349-109416371 ATTTAGCTGGGAGTGATGGCAGG - Intronic
1013413925 6:109907608-109907630 AATTAGCTGGGCATGATGGCAGG + Intergenic
1013505767 6:110798473-110798495 AATTAGCTGGGCATGATGGCAGG + Intronic
1013802653 6:113965515-113965537 AGTTAGCTGGGCATGGTGACGGG - Intronic
1014148019 6:118020865-118020887 AGTTATCTGAGAAAATTGACTGG + Intronic
1014207723 6:118674373-118674395 AATTAGCTGGGCATGGTGACAGG + Intronic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014600727 6:123408527-123408549 AATTAGCTGGGCAAGGTGGCGGG + Intronic
1014885935 6:126781437-126781459 AATTAGCTGGGAATGGTGGCAGG - Intergenic
1015528897 6:134201207-134201229 AATTAGCTGGGCATGGTGACGGG - Intronic
1015871650 6:137781594-137781616 AGTTAGCTGGGCATGATAGCCGG + Intergenic
1015960484 6:138643847-138643869 AGTTAGCTGGGCATGGTGACGGG + Intronic
1015986501 6:138889466-138889488 AATTAGCTGGGCATGGTGACGGG - Intronic
1016027558 6:139302625-139302647 AATTAGCTGGGAATGGTGGCGGG + Intergenic
1016047420 6:139495165-139495187 AATTAGCTGGGCATGGTGACGGG - Intergenic
1016052313 6:139542926-139542948 AATTAGCTGGGCATGATGGCAGG + Intergenic
1016148338 6:140704017-140704039 AATTAGCTGGACATGATGACAGG + Intergenic
1016394067 6:143603948-143603970 AGTTACCTGGGCATGGTGACAGG + Intronic
1016463819 6:144306388-144306410 AGGTAGCTGGGAAGGAGGAGAGG + Intronic
1016541572 6:145171243-145171265 AGTTAGCCGGGCATGATGGCAGG + Intergenic
1016774364 6:147888734-147888756 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1016798195 6:148140713-148140735 AATTAGCTGGGCATGGTGACAGG - Intergenic
1016832335 6:148446255-148446277 AATTAGCTGGGCATGATGGCGGG - Intronic
1016931844 6:149419166-149419188 AATTAGCTGGGCATGATGGCAGG - Intergenic
1016956425 6:149631248-149631270 AATTAGCTGGGCATGATGGCAGG + Intronic
1016970426 6:149757004-149757026 AATTAGCTGGGCATGGTGACAGG + Intronic
1017035784 6:150265978-150266000 AATTAGCTGGGCATGATGGCAGG + Intergenic
1017133964 6:151132156-151132178 AATTAGCTGGGCATGATGGCAGG + Intergenic
1017154197 6:151308359-151308381 AGTTAGCTGGGCATGATGGCAGG - Intronic
1017196898 6:151711368-151711390 AATTAGCTGGGCATGATGGCGGG - Intronic
1017230424 6:152067676-152067698 AGTTAGCTGGGCACGGTGGCGGG + Intronic
1017848702 6:158283682-158283704 AGTTAGTTCTGAAGGATGACTGG - Intronic
1017900170 6:158712905-158712927 AATTAGCTGGGCAAGGTGGCGGG - Intronic
1018170849 6:161142009-161142031 AATTAGCTGGGCATGATGGCAGG - Intronic
1018192643 6:161324007-161324029 AATTAGCTGGGCAAGGTGGCGGG + Intergenic
1018325094 6:162658510-162658532 AATTAGCTGGGCATGATGGCGGG + Intronic
1018640563 6:165900321-165900343 AATTAGCTGGGCATGATGTCAGG + Intronic
1018764168 6:166918355-166918377 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1018771288 6:166973462-166973484 AATTAGCTGGGTGAGATGGCGGG + Intergenic
1019110961 6:169713449-169713471 AATTAGCTGGGCAAGGTGGCGGG + Intronic
1019373256 7:674676-674698 AGTTAGCTGGGCATGACGAGTGG - Intronic
1019373845 7:678120-678142 AATTAGCTGGGAAAGGTGGTGGG + Intronic
1019495588 7:1338591-1338613 AATTAGCTGGGCATGATGGCGGG + Intergenic
1019801052 7:3088735-3088757 AGTTAGCCGGGCATGGTGACAGG - Intergenic
1020142099 7:5617848-5617870 AATTAGCTGGGCATGATGGCGGG - Intergenic
1020193330 7:6017372-6017394 AATTAGCTGGGCATGGTGACAGG + Intronic
1020223858 7:6264096-6264118 AATTAGCTGGGCATGATGGCGGG + Intronic
1020886795 7:13828390-13828412 AATTAGCTGGGCATGGTGACGGG - Intergenic
1021083429 7:16390547-16390569 AGTTAGTTTGGGAAGATGAGAGG - Intronic
1021144439 7:17067414-17067436 AGTCAGCTGGGAAATAACACAGG - Intergenic
1021181676 7:17514049-17514071 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1021372404 7:19865158-19865180 AATTAGCTGGGAATGGTGATGGG + Intergenic
1021503591 7:21356403-21356425 AGTTAGCTGGGCATGACGGCAGG - Intergenic
1021805374 7:24349563-24349585 AGTGAGCTGGGAAGGCAGACAGG + Intergenic
1021879816 7:25083920-25083942 AATTAGCTGGGCATGATGGCGGG - Intergenic
1022065107 7:26846830-26846852 AGTTAGCCGGGCATGATGGCAGG + Intronic
1022159742 7:27697411-27697433 AATTAGCTGGGCATGATGGCAGG + Intergenic
1022415993 7:30177429-30177451 TGACAGCTGGGAAAGATGGCAGG + Intergenic
1022649435 7:32260959-32260981 AATTAGCTGGGCATGATGGCAGG + Intronic
1022779877 7:33569611-33569633 AATTAGCTGGGAAGGGTGGCTGG + Intronic
1023029048 7:36077270-36077292 AATTAGCTGGGCATGATGGCGGG + Intergenic
1023182204 7:37496294-37496316 AATTAGCTGGGAATGGTGGCAGG - Intergenic
1023407401 7:39849148-39849170 AATTAGCTGGGCATGATGGCAGG + Intergenic
1023533309 7:41181963-41181985 AATTAGCTGGGCATGGTGACAGG + Intergenic
1023860497 7:44215263-44215285 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG + Intronic
1024237973 7:47412467-47412489 ATTTAGCTGGGCATGATGGCAGG + Intronic
1024486253 7:49923972-49923994 AATTAGCTGGGCATGATGGCAGG + Intronic
1024734366 7:52288400-52288422 AATTAGCTGGGTATGATGGCGGG - Intergenic
1024744514 7:52390868-52390890 AGTTAGCTGGGCATGATGGTGGG - Intergenic
1025123626 7:56327899-56327921 AATTAGCTGGGCATGATGGCGGG - Intergenic
1025216044 7:57057491-57057513 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1025626782 7:63229895-63229917 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1025655335 7:63513213-63513235 AATTAGCTGGGCAAGGTGGCAGG - Intergenic
1025705031 7:63855389-63855411 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1025752159 7:64303094-64303116 AGTTGGCTGGGCATGATGACAGG + Intergenic
1025982441 7:66417998-66418020 AGTTAGCTAGGCACGATGATGGG - Intronic
1026037656 7:66841001-66841023 AGTTAGCTGGGCATGGTGGCTGG - Intergenic
1026053219 7:66964147-66964169 AATTAGCTGGGCATGGTGACAGG - Intergenic
1026062471 7:67038455-67038477 AGTTAGCTGGGCATGGTGGCTGG + Intronic
1026168101 7:67928982-67929004 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1026478237 7:70755516-70755538 AATTAGCTGGGCATGATGGCAGG + Intronic
1026652465 7:72227389-72227411 AATTAGCTGGGAGTGGTGACGGG + Intronic
1026724527 7:72860214-72860236 AATTAGCTGGGCATGGTGACGGG + Intergenic
1026771234 7:73201149-73201171 AGTTAGCTGGGCATGATGGCGGG + Intergenic
1026835875 7:73638769-73638791 AATTAGCTGGGCATGGTGACAGG - Intergenic
1026954240 7:74366725-74366747 AATTAGCTGGGCATGGTGACGGG + Intronic
1026954916 7:74371093-74371115 AGTTAGCTGGGCATGATGGTAGG + Intronic
1026978836 7:74514906-74514928 AATTAGCTGGGTAAGGTGGCAGG + Intronic
1027002977 7:74667192-74667214 AGTTAGCTGGGAGTGGTGACAGG + Intronic
1027012102 7:74754546-74754568 AGTTAGCTGGGCATGATGGCGGG + Intronic
1027075939 7:75191508-75191530 AGTTAGCTGGGCATGATGGCGGG - Intergenic
1027254572 7:76422847-76422869 AGTTAGCCGGGCATGGTGACGGG + Intronic
1027259236 7:76452477-76452499 AGTTAGCTGGGCATGGTGATAGG - Intergenic
1027310606 7:76950559-76950581 AGTTAGCTGGGCATGGTGATAGG - Intergenic
1027392092 7:77714812-77714834 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1027582254 7:80012791-80012813 AATTAGCTGGGCATGGTGACGGG + Intergenic
1027778354 7:82493315-82493337 AATTAGCTGGGCATGATGGCAGG - Intergenic
1028414464 7:90565594-90565616 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1028959119 7:96729019-96729041 AATTAGCTGGGCATGGTGACAGG - Intergenic
1029102517 7:98144282-98144304 AATTAGCTGGGCATGGTGACGGG + Intronic
1029282159 7:99442505-99442527 AATTAGCTGGGCAAGGTGGCGGG + Intronic
1029289362 7:99490301-99490323 AATTAGCTGGGCATGCTGACAGG - Intronic
1029417447 7:100451906-100451928 AATTAGCTGGGCATGATGGCAGG - Intergenic
1029542466 7:101192260-101192282 AATTAGCTGGGCATGGTGACAGG - Intergenic
1029587704 7:101486022-101486044 AATTAGCTGGGCACGGTGACGGG + Intronic
1029635139 7:101778553-101778575 AATTAGCTGGGCATGATGGCGGG - Intergenic
1030052823 7:105553867-105553889 AATTAGCTGGGTATGGTGACGGG - Intronic
1030056467 7:105587827-105587849 AATTAGCTGGGCATGATGGCAGG - Intronic
1030539257 7:110809045-110809067 TTTTATTTGGGAAAGATGACAGG - Intronic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031038583 7:116814862-116814884 AATTAGCTGGGCATGATGGCAGG + Intronic
1031043057 7:116858948-116858970 AATTAGCTGGGCATGATGGCAGG + Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031606139 7:123770291-123770313 AGTTAGCTGGGTGTGGTGACGGG + Intergenic
1032150074 7:129421101-129421123 AATTAGCTGGGCATGATGGCAGG + Intronic
1032157545 7:129481346-129481368 AATTAGCTGGGAAAGGTGGCAGG + Intronic
1032170168 7:129577969-129577991 AGTTAGCTTCCAAAGAAGACAGG + Intergenic
1032199661 7:129810695-129810717 AATTAGCTGGGCATGATGGCAGG - Intergenic
1032418886 7:131761906-131761928 AATTAGCTGGGCATGATGGCAGG + Intergenic
1032568595 7:132974723-132974745 AATTAGCTGGGCACGATGGCAGG + Intronic
1032696812 7:134344354-134344376 AATTAGCTGGGCATGATGGCGGG - Intergenic
1032827910 7:135590258-135590280 AGTTAGCTGGGCATGATGGCGGG - Intronic
1033246421 7:139720239-139720261 AGTGAGTTGGGAATGATCACTGG - Intronic
1033296346 7:140140623-140140645 AATTAGCTGGGCACGATGGCCGG + Intronic
1033347467 7:140536809-140536831 AATTAGCTGGGCATGATGGCAGG - Intronic
1033378714 7:140790950-140790972 AATTAGCTGGGCATGATGGCGGG + Intronic
1033516732 7:142113980-142114002 AATTAGCTGGGCATGATGGCGGG + Intronic
1033543116 7:142375511-142375533 AATTAGCTGGGCATGGTGACAGG + Intergenic
1034039112 7:147858233-147858255 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1034128312 7:148693845-148693867 AATTAGCTGGGGATGGTGACAGG + Intergenic
1034211092 7:149363857-149363879 ACTTATCTGGCAAAGATGAAAGG + Intergenic
1034242173 7:149618953-149618975 AATTAGCTGGGCACGATGGCAGG + Intergenic
1034319775 7:150169232-150169254 AGTTAGCTGGGCATGGTGACAGG + Intergenic
1034623665 7:152475888-152475910 AGTTAGCTGGGCATGTTGGCAGG + Intergenic
1034623982 7:152478523-152478545 AATTAGCTGGGTATGATGGCGGG - Intergenic
1034647084 7:152657446-152657468 AATTAGCTGGGCATGATGGCGGG - Intronic
1034678006 7:152905674-152905696 AATTAGCTGGGCATGATGGCAGG - Intergenic
1034772976 7:153797988-153798010 AATTAGCTGGGCATGGTGACGGG - Intergenic
1034915757 7:155037488-155037510 AATTAGCTGGGCAAGGTGGCAGG - Intergenic
1034987667 7:155527198-155527220 AATTAGCTGGGCATGGTGACAGG - Intronic
1034995664 7:155575688-155575710 AATTAGCTGGGCATGATGGCGGG + Intergenic
1035131808 7:156661466-156661488 AATTAGCTGGGCATGATGGCGGG - Intronic
1035450750 7:158975632-158975654 ACATAGCTGGGAAGGAAGACAGG + Intergenic
1035875162 8:3180776-3180798 AATTAGCTGGGCATGGTGACGGG - Intronic
1035889244 8:3325673-3325695 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1036409176 8:8482687-8482709 AATTAGCTGGGCATGGTGACAGG + Intergenic
1036411944 8:8510255-8510277 AATTAGCTGGGCATGGTGACGGG + Intergenic
1036435643 8:8730604-8730626 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1036607284 8:10318761-10318783 GCTTCACTGGGAAAGATGACTGG - Intronic
1037142170 8:15532939-15532961 AATTAGCTGGGCATGGTGACAGG - Intronic
1037237841 8:16741544-16741566 AATGAGCTGGGAATGTTGACAGG + Intergenic
1037326838 8:17700319-17700341 AATTAGCTGGGCATGGTGACAGG + Intronic
1037562816 8:20089807-20089829 AATTAGCTGGGCAAGGTGGCGGG - Intergenic
1037885048 8:22591559-22591581 AGTGAGCTGGGCAAGAAGGCTGG - Exonic
1038005461 8:23426189-23426211 AATTAGCTGGGCAAGGTGGCGGG - Intronic
1038154944 8:24980402-24980424 AATTAGCTGGGCATGGTGACGGG - Intergenic
1038413986 8:27379887-27379909 AATTAGCTGGGCATGGTGACGGG - Intronic
1038573128 8:28680240-28680262 AATTAGCTGGGCATGATGGCAGG + Intronic
1038620641 8:29139631-29139653 TGTTTACTGGGAAAGAGGACTGG + Intronic
1039061584 8:33576021-33576043 AATTAGCTGGGCATGATGGCGGG - Intergenic
1039259898 8:35760189-35760211 AATTAGCTGGGCATGGTGACGGG - Intronic
1039298511 8:36183859-36183881 AATTAGCTGGGCATGGTGACAGG - Intergenic
1039632238 8:39124564-39124586 AATTAGCTGGGCATGATGGCAGG - Intronic
1039967734 8:42295574-42295596 AATTAGCTGGGCATGGTGACGGG + Intronic
1039997386 8:42545677-42545699 AATTAGCTGGGCATGATGGCGGG - Intronic
1040015654 8:42696928-42696950 AATTAGCTGGGCATGATGGCAGG + Intergenic
1040095525 8:43438851-43438873 AATTAGCTGGGCATGATGGCAGG - Intergenic
1040281040 8:46043728-46043750 CCTTAGTTGGGAATGATGACAGG - Intergenic
1040513413 8:48115461-48115483 AATTAGCTGGGCATGGTGACAGG - Intergenic
1041060835 8:54032888-54032910 AATTAGCTGGGCATGATGGCAGG + Intergenic
1041399294 8:57424915-57424937 AGTGAGTTTTGAAAGATGACTGG - Intergenic
1041506047 8:58598875-58598897 AATTAGCTGGGCATGATGGCAGG + Intronic
1041572964 8:59358465-59358487 AATTAGCTGGGCATGATGGCGGG - Intergenic
1041641046 8:60202190-60202212 AATTAGCTGGGAATGGTGGCAGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042630970 8:70815672-70815694 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1042663526 8:71181146-71181168 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1042757755 8:72235974-72235996 AATTAGCTGGGCATGATGGCGGG - Intergenic
1043072458 8:75656144-75656166 AGTTTGCTGAGAATGATGACTGG - Intergenic
1043186342 8:77155639-77155661 AATTAGCTGGGCATGATGGCGGG - Intergenic
1043397493 8:79853217-79853239 AATTAGCTGGGCATGATGGCGGG + Intergenic
1043526610 8:81104588-81104610 AGTTTGCAGGAGAAGATGACAGG - Intronic
1043878263 8:85510839-85510861 AGTTAGCTGGGCATGATGGCAGG + Intergenic
1044457667 8:92406914-92406936 AATTAGCTGGGCATGATGGCAGG + Intergenic
1044511273 8:93082468-93082490 AATTAGCTGGGCATGATGGCGGG - Intergenic
1044644439 8:94423232-94423254 AATTAGCTGGGCATGGTGACAGG + Intronic
1044674523 8:94716131-94716153 ACTTAGCTGGGAGTGGTGACAGG + Intergenic
1044847380 8:96395438-96395460 AATTAGCTGGGAACGGTGGCGGG + Intergenic
1045471585 8:102517515-102517537 AGTTAGCAGGGAGAAAGGACAGG - Intergenic
1045569706 8:103356190-103356212 AGTTAGAAGGAAAAGGTGACAGG + Intergenic
1045646836 8:104307622-104307644 AGTTTGCTGGGTAAGAGGCCAGG - Intergenic
1045827303 8:106413870-106413892 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1045856992 8:106775817-106775839 AATTAGCTGGGCACGGTGACAGG + Intergenic
1046903982 8:119553109-119553131 AATTAGCTGGGCATGGTGACGGG + Intergenic
1047098373 8:121648840-121648862 AATTAGCTGGGCATGATGGCAGG - Intergenic
1047157286 8:122333464-122333486 AATTAGCTGGGCATGATGGCGGG + Intergenic
1047267652 8:123322518-123322540 AATTAGCTGGGCATGATGGCAGG + Intronic
1047272214 8:123373039-123373061 AATTAGCCGGGCGAGATGACAGG - Intronic
1047811263 8:128411833-128411855 AATTAGCTGGGCATGTTGACTGG - Intergenic
1047834211 8:128670433-128670455 AGTTAGCTGGAAAGGAAGAATGG - Intergenic
1047990543 8:130281915-130281937 AGTTAGCGGGGCAAGGTGGCGGG + Intronic
1048173653 8:132131937-132131959 AATTAGCTGGGCATGATGGCAGG + Intronic
1048380178 8:133858693-133858715 AGTTGCCTGAGAATGATGACTGG - Intergenic
1048551167 8:135434811-135434833 AATTAGCTGGGCATGGTGACAGG - Intergenic
1048751867 8:137686539-137686561 AGTTAGCTGGAAGAAAAGACAGG + Intergenic
1048771985 8:137904904-137904926 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1048882440 8:138881976-138881998 CGGTAGTTGGGAAAGTTGACTGG - Intronic
1049028136 8:140011824-140011846 AATTAGCTGGGTGAGATGGCAGG - Intronic
1049305003 8:141897932-141897954 AATTAGCTGGGCATGATGGCGGG + Intergenic
1049381335 8:142317807-142317829 AATTAGCTGGGCATGGTGACGGG + Intronic
1049485871 8:142860500-142860522 AATTAGCTGGGCATGATGGCAGG + Intronic
1049632926 8:143668796-143668818 AATTAGCCGGGCAAGATGGCGGG + Intergenic
1049844738 8:144794379-144794401 AGTTAGCTGGGTATGGTGGCAGG + Intergenic
1049861868 8:144904237-144904259 AATTAGCTGGGCATGATGGCAGG - Intergenic
1049863510 8:144917650-144917672 AATTAGCTGGGCATGGTGACGGG + Intergenic
1049995160 9:1027376-1027398 AATTAGCTGGGCATGGTGACAGG - Intergenic
1050091921 9:2024046-2024068 AGTGAGCTGTGAAAAAAGACAGG + Intronic
1050205492 9:3191919-3191941 AGGTACCTGGGAAAGATAATTGG - Intergenic
1050341398 9:4643154-4643176 AATTAGCTGGGAATGATGTCAGG - Intronic
1050487875 9:6153944-6153966 AATTAGCTGGGCATGGTGACGGG - Intergenic
1050513742 9:6420554-6420576 AATTAGCCGGGCATGATGACGGG + Intronic
1050540504 9:6665393-6665415 AATTAGCTGGGCATGATGGCGGG + Intergenic
1050768983 9:9173035-9173057 AGTCAGGAGGAAAAGATGACTGG - Intronic
1051111289 9:13639928-13639950 AATTAGCTGGGCATGGTGACGGG - Intergenic
1051139636 9:13964391-13964413 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1051394633 9:16606704-16606726 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1051427942 9:16952955-16952977 CGTTAGCTGGGCATGATGGCAGG - Intergenic
1051490707 9:17661011-17661033 AATTAGCTGGGCACGATGGCAGG + Intronic
1051848122 9:21475901-21475923 AATTAGCTGGGAGTGGTGACAGG + Intergenic
1051887357 9:21907407-21907429 AATTAGCTGGGCATGATGGCAGG + Intronic
1052128804 9:24814793-24814815 AGTTACTTGGAAAAGATGATTGG - Intergenic
1052178190 9:25490714-25490736 AATTAGCTGGGGATGATGGCAGG - Intergenic
1052242581 9:26292018-26292040 AATTAGCTGGGCATGATGGCCGG - Intergenic
1052253558 9:26427342-26427364 AATTAGCTGGGCATGGTGACAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052577356 9:30307174-30307196 AATTAGCTGGGCATGGTGACTGG - Intergenic
1053098402 9:35349064-35349086 AATTAGCTGGGAGTGATGGCAGG - Intronic
1053179426 9:35955754-35955776 AATTAGCTGGGCATGATGCCAGG + Intergenic
1053201791 9:36157163-36157185 AATTAGCTGGGCATGATGGCGGG - Intronic
1053220352 9:36307401-36307423 AATTAGCTGGGCATGATGGCGGG + Intergenic
1053244147 9:36520589-36520611 AATTAGCTGGGCATGATGGCGGG - Intergenic
1053419104 9:37965722-37965744 AATTAGCTGGGCATGGTGACAGG - Intronic
1053505175 9:38637161-38637183 AATTAGCTGGGCATGGTGACGGG - Intergenic
1053599817 9:39599316-39599338 AATTAGCTGGGCACGATGGCGGG + Intergenic
1053667758 9:40328275-40328297 AATTAGCTGGGCATGATGATTGG + Intronic
1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG + Intergenic
1053707656 9:40770732-40770754 AATTAGCTGGGCATGATGGCAGG - Intergenic
1054253710 9:62743070-62743092 AATTAGCTGGGCACGATGGCGGG - Intergenic
1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054417569 9:64891518-64891540 AATTAGCTGGGCATGATGGCAGG - Intergenic
1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054490841 9:65773709-65773731 AGTTAACTGGAGAAGATGACCGG - Intergenic
1054516853 9:66048008-66048030 AATTAGCTGGGCATGATGATTGG - Intergenic
1054567771 9:66777233-66777255 AATTAGCTGGGCACGATGGCGGG - Intergenic
1055106610 9:72519734-72519756 AATTAGCTGGGCATGATGGCAGG + Intergenic
1055360022 9:75479488-75479510 AATTAGCTGGGCATGGTGACAGG + Intergenic
1055412629 9:76047243-76047265 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1055658663 9:78478694-78478716 AATTAGCTGGGCATGATGGCAGG - Intergenic
1055958458 9:81796355-81796377 AATTAGCCGGGCAAGATGGCGGG - Intergenic
1056115603 9:83438546-83438568 AATTAGCTGGGCATGGTGACAGG - Intronic
1056138410 9:83650878-83650900 AATTAGCTGGGCATGGTGACGGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056373778 9:85986731-85986753 AGTTAGCCGGGCATGGTGACAGG - Intronic
1056416015 9:86376891-86376913 AATTAGCTGGGCATGATGGCAGG - Intergenic
1056438161 9:86593600-86593622 AATTAGCTGGGCATGATGGCAGG - Intergenic
1056891234 9:90494889-90494911 AATTAGCTGGGCATGATGATGGG - Intergenic
1057090032 9:92249402-92249424 AGTTAGCTGGGCATGGTGGCGGG + Intronic
1057165557 9:92922448-92922470 AGTTAGCTGGGCATGGTGGCAGG + Intergenic
1057336909 9:94162807-94162829 AATTAGCTGGGAATGGTGGCAGG + Intergenic
1057350558 9:94293564-94293586 ATTTAGCTGGGCATGATGGCGGG - Intronic
1057361544 9:94377953-94377975 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1057405263 9:94764497-94764519 AGTTAGCTGGGCATGGTGGCAGG + Intronic
1057472145 9:95367458-95367480 AATTAGCTGGGAGTGATGGCGGG + Intergenic
1057589978 9:96364184-96364206 AATTAGCTGGGAATGGTGGCAGG + Intronic
1057661815 9:97010220-97010242 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1057807946 9:98234049-98234071 AGCAAGCAGGGAAAGATGCCAGG - Intronic
1057890868 9:98868787-98868809 AGTTAGCTGGGCATGGTGGCAGG - Intergenic
1057939420 9:99268064-99268086 AATTAGCTGGGCATGATGGCAGG - Intergenic
1058167287 9:101634182-101634204 AGTTAGTTGGGAATGGTGGCGGG + Intronic
1058409929 9:104720280-104720302 ATTTAGCTGGGCATGATGGCGGG + Intergenic
1058411466 9:104737692-104737714 AATTAGCCGGGCATGATGACGGG + Intergenic
1058445300 9:105049805-105049827 AATTAGCTGGGCATGGTGACGGG + Intergenic
1058997328 9:110313052-110313074 AATTAGCTGGGTAAGGTGGCGGG - Intronic
1059139857 9:111842865-111842887 AATTAGCTGGGCATGGTGACAGG - Intergenic
1059143936 9:111880213-111880235 AATTAGCTGGGCATGATGGCGGG + Intergenic
1059193141 9:112346002-112346024 AATTAGCTGGGCATGATGGCGGG - Intergenic
1059216403 9:112567807-112567829 AGTTAGCCGGGCATGATGGCAGG + Intronic
1059623450 9:116034804-116034826 AGTTAGCTGGGTGTGGTGACAGG - Intergenic
1059893366 9:118831640-118831662 AGTTATCTGTGCAGGATGACAGG - Intergenic
1059969250 9:119648157-119648179 AATTAGCTGGGCATGATGGCAGG + Intergenic
1060068610 9:120526893-120526915 AGTTAGTTGGGAAGGAAGGCAGG - Intronic
1060100061 9:120832543-120832565 AATTAGCTGGGCATGATGGCAGG - Intronic
1060299019 9:122363177-122363199 AGTTAGCTGGGCAAGGTGGCGGG - Intergenic
1060355947 9:122907207-122907229 ATTTAGCCGGGCATGATGACGGG - Intergenic
1060463156 9:123877672-123877694 AGTTAGCTGGGAGTGGTGGCGGG + Intronic
1060512445 9:124243709-124243731 AATTAGCTGGGAGTGATGGCGGG + Intergenic
1060577471 9:124709784-124709806 AATTAGCTGGGAAAGGTGGCAGG + Intronic
1060749724 9:126161327-126161349 AATTAGCTGGGCAAGGTGTCAGG - Intergenic
1060750977 9:126169112-126169134 AATTAGCTGGGCAAGGTGGCGGG + Intergenic
1060911504 9:127354939-127354961 AGTTAGCTGGGAATGCTGGCGGG - Intronic
1061315241 9:129791467-129791489 AATTAGCTGGGCATGATGGCGGG + Intergenic
1061348501 9:130044785-130044807 AGTTAGCTGGGCGTGGTGACAGG + Intergenic
1061393262 9:130329589-130329611 AATTAGCTGGGCATGATGGCAGG - Intronic
1061492463 9:130953447-130953469 AATTAGCTGGGCATGGTGACGGG - Intergenic
1061764204 9:132871095-132871117 AGTTAGCTGGGCATGGTGGCGGG + Intronic
1061830271 9:133287817-133287839 AATTAGCTGGGCATGGTGACAGG - Intergenic
1061855316 9:133438763-133438785 AATTAGCTGGGCATGATGGCGGG + Intronic
1061981744 9:134108974-134108996 AGTTAGCTGGGCATGGTGACGGG + Intergenic
1062103670 9:134741124-134741146 AATCAGCTGTGAAAGATCACTGG + Intronic
1062508671 9:136892313-136892335 AATTAGCTGGGCATGGTGACTGG + Intronic
1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG + Intergenic
1203731545 Un_GL000216v2:96001-96023 AGTTAGCTGGGCATGGTGTCAGG - Intergenic
1185472149 X:390361-390383 AATTAGCTGGGCATGATGGCGGG + Intergenic
1185474205 X:404064-404086 AATTAGCTGGGCATGATGGCAGG - Intergenic
1185516030 X:699782-699804 AATTAGCTGGGCATGGTGACGGG - Intergenic
1185525586 X:775821-775843 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1185557213 X:1030819-1030841 AATTAGCTGGGAGTGATGGCGGG + Intergenic
1186417775 X:9398593-9398615 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1186494358 X:10000220-10000242 AATTAGCCGGGCATGATGACAGG - Intergenic
1186842841 X:13502144-13502166 AATTAGCTGGGCATGATGGCAGG + Intergenic
1187050327 X:15689375-15689397 AGTTAGCTGGGCGTGGTGACGGG - Intronic
1187421544 X:19138511-19138533 AATTAGCTGGGCATGATGGCGGG - Intergenic
1187445547 X:19357605-19357627 AGTTAGTTAGGAACGATGACTGG - Intronic
1187457405 X:19454511-19454533 AGGTATCAGGGAAAGCTGACCGG + Intronic
1187496704 X:19801927-19801949 AATTAGCTGGGCATGATGGCAGG + Intronic
1187503443 X:19859295-19859317 AATTAGCTGGGCATGATGGCAGG - Intronic
1187808500 X:23148482-23148504 AATTAGCTGGGCATGATGGCGGG - Intergenic
1187862925 X:23699019-23699041 AATTAGCTGGGCATGATGGCAGG - Intergenic
1187894617 X:23968843-23968865 AGTTAGCTGGGTATGGTGCCAGG - Intergenic
1188068693 X:25693988-25694010 AATTAGCTGGGCATGCTGACAGG + Intergenic
1188416584 X:29942766-29942788 AATTAGCTGGGTGTGATGACGGG - Intronic
1188544527 X:31289128-31289150 AATTAGCTGGGCATGATGGCGGG + Intronic
1188548233 X:31334079-31334101 AGTTAGCTGGGCATGGTGACAGG - Intronic
1189066925 X:37820020-37820042 AATTAGCTGGGCATGATGGCGGG - Intronic
1189349336 X:40265345-40265367 AGGCAGCTGGGAAAGGTGACAGG + Intergenic
1189492301 X:41479755-41479777 AATTAGCTGGGCATGATGGCGGG - Intergenic
1189763951 X:44350151-44350173 AATTAGCTGGGCATGGTGACAGG - Intergenic
1189779511 X:44500561-44500583 AATTAGCTGGGCATGATGGCGGG + Intergenic
1190307164 X:49090967-49090989 AGTTAGCTGGGCATGGTGGCGGG - Intronic
1190586905 X:51954052-51954074 AGTGAGCTGGGAAGGATGAGGGG - Intergenic
1190754991 X:53393998-53394020 AATTAGCTGGGCATGATGGCGGG + Intronic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192461056 X:71317979-71318001 AGTTAGCTGGGCATGCTGACGGG - Intergenic
1192478722 X:71466524-71466546 AATTAGCTGGGCATGATGGCAGG - Intronic
1192577954 X:72257974-72257996 AGGCAGCTGGGAAGGATGAGTGG + Intronic
1192611008 X:72566994-72567016 AATTAGCTGGGCATGATGGCGGG + Intronic
1192732949 X:73819349-73819371 AGTTAGCCGGGCATGATGGCGGG + Intergenic
1192774271 X:74225610-74225632 AATTAGCTGGGCATGATGGCAGG - Intergenic
1193730561 X:85097484-85097506 AATTAGCTGGGCATGATGGCAGG - Intronic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194199000 X:90932468-90932490 AATTAGCTGGGCATGATGGCGGG + Intergenic
1194270513 X:91808344-91808366 AATTAGCTGGGCATGGTGACGGG + Intronic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194626387 X:96230974-96230996 AATTAGCTGGGAATTATGACAGG - Intergenic
1194742365 X:97589166-97589188 AATTAGCTGGGCATGATGACGGG + Intronic
1194763975 X:97827679-97827701 GATTAGCTCTGAAAGATGACAGG + Intergenic
1194887394 X:99333713-99333735 AGTTAGCTGGGCATGGTGGCGGG - Intergenic
1195096474 X:101505988-101506010 AATTAGCCGGGAGTGATGACAGG - Intronic
1195101456 X:101558766-101558788 AATTAGCTGGGCATGATGGCGGG - Intergenic
1195228465 X:102822239-102822261 AGTTATCTAGGAAAGATGGCAGG - Intergenic
1195379931 X:104260855-104260877 AGTTAGCTGGGCATGGTCACAGG - Intergenic
1195555841 X:106222100-106222122 AGGTATCTGGGGAAGAAGACAGG + Intergenic
1195610123 X:106857299-106857321 AATTAGCTGGGCATGGTGACAGG - Intronic
1195953788 X:110307094-110307116 AATTAGCTGGGCATGATGGCAGG + Intronic
1195976836 X:110535897-110535919 AATTAGCTGGGCATGATGGCAGG - Intergenic
1196571129 X:117267335-117267357 AATTAGCTGGGCAAGGTGGCAGG + Intergenic
1196673866 X:118398776-118398798 AATTAGTTGGGCATGATGACAGG + Intronic
1196722619 X:118869159-118869181 AATTAGCTGGGAATGGTGGCAGG - Intergenic
1196747889 X:119087849-119087871 AGTCAACTGGGAAAGATGTCTGG + Exonic
1196929854 X:120670753-120670775 AATTAGCTGGGCATGATGGCAGG - Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197282243 X:124550905-124550927 AGTTAGCTGGGCATGGTGGCAGG - Intronic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1197803929 X:130381297-130381319 AATTAGCTGGGCACGATGGCAGG - Intergenic
1198227629 X:134660251-134660273 AATTAGCTGGGCATGATGGCAGG - Intronic
1198251457 X:134883052-134883074 AATTAGCTGGGCATGGTGACGGG + Intergenic
1198416694 X:136427463-136427485 AGTTAACTGTGTAAGATGATGGG - Intergenic
1198537119 X:137597640-137597662 AGTTAGCTGGGCATGGTGTCAGG - Intergenic
1198579951 X:138052259-138052281 AATTAGCTGGGCATGATGGCAGG + Intergenic
1198728668 X:139703584-139703606 AATTAGCTGGGCATGATGGCGGG + Intronic
1198803239 X:140468958-140468980 AGTTAGCTGGGCATGGTGGCGGG + Intergenic
1199118070 X:144016049-144016071 ATTTAGCTGGGAAAGCAGTCAGG + Intergenic
1199580347 X:149354143-149354165 AGTTACCTGTGAATGATGGCAGG - Intergenic
1199621284 X:149704059-149704081 AGTTAGCAGTGGAAGATGGCTGG - Intronic
1200098985 X:153679718-153679740 AATTAGCTGGGCATGGTGACGGG - Intronic
1200205716 X:154314671-154314693 AATTAGCTGGGCATGATGGCGGG - Intronic
1200245054 X:154518836-154518858 AATTAGCTGGGTATGATGGCAGG - Intergenic
1200291160 X:154875661-154875683 AGTCAGCTGTGAAAGAGTACTGG + Intronic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200544996 Y:4508900-4508922 AATTAGCTGGGCATGATGGCGGG + Intergenic
1200587747 Y:5029772-5029794 AATTAGCTGGGCATGGTGACGGG + Intronic
1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG + Intergenic
1201317255 Y:12659862-12659884 AATTAGCTGGGCAAGATGACGGG - Intergenic
1201321847 Y:12707885-12707907 AATTAGCTGGGCATGGTGACAGG - Intronic
1201645701 Y:16228807-16228829 AGTTAGCTGGGCATGATGGTGGG - Intergenic
1201657112 Y:16356509-16356531 AGTTAGCTGGGCATGATGGTGGG + Intergenic
1202276167 Y:23122267-23122289 AGTTAGCTGGGCATCATGACAGG + Intergenic
1202289861 Y:23298424-23298446 AGTTAGCTGGGCATCATGACAGG - Intergenic
1202350737 Y:23987783-23987805 AGTTAGATGGGCATGATGGCAGG - Intergenic
1202429160 Y:24755989-24756011 AGTTAGCTGGGCATCATGACAGG + Intergenic
1202441631 Y:24914100-24914122 AGTTAGCTGGGCATCATGACAGG - Intergenic
1202520042 Y:25682337-25682359 AGTTAGATGGGCATGATGGCAGG + Intergenic