ID: 999993938

View in Genome Browser
Species Human (GRCh38)
Location 5:157073924-157073946
Sequence TTGAACAATATGAGGGCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999993938_999993942 5 Left 999993938 5:157073924-157073946 CCACTAGCCCTCATATTGTTCAA No data
Right 999993942 5:157073952-157073974 AACTATATATATTTATTTGAGGG No data
999993938_999993941 4 Left 999993938 5:157073924-157073946 CCACTAGCCCTCATATTGTTCAA No data
Right 999993941 5:157073951-157073973 CAACTATATATATTTATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999993938 Original CRISPR TTGAACAATATGAGGGCTAG TGG (reversed) Intergenic
No off target data available for this crispr