ID: 999993941

View in Genome Browser
Species Human (GRCh38)
Location 5:157073951-157073973
Sequence CAACTATATATATTTATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999993938_999993941 4 Left 999993938 5:157073924-157073946 CCACTAGCCCTCATATTGTTCAA No data
Right 999993941 5:157073951-157073973 CAACTATATATATTTATTTGAGG No data
999993939_999993941 -3 Left 999993939 5:157073931-157073953 CCCTCATATTGTTCAAGAGTCAA No data
Right 999993941 5:157073951-157073973 CAACTATATATATTTATTTGAGG No data
999993940_999993941 -4 Left 999993940 5:157073932-157073954 CCTCATATTGTTCAAGAGTCAAC No data
Right 999993941 5:157073951-157073973 CAACTATATATATTTATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999993941 Original CRISPR CAACTATATATATTTATTTG AGG Intergenic
No off target data available for this crispr