ID: 999993942

View in Genome Browser
Species Human (GRCh38)
Location 5:157073952-157073974
Sequence AACTATATATATTTATTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999993940_999993942 -3 Left 999993940 5:157073932-157073954 CCTCATATTGTTCAAGAGTCAAC No data
Right 999993942 5:157073952-157073974 AACTATATATATTTATTTGAGGG No data
999993939_999993942 -2 Left 999993939 5:157073931-157073953 CCCTCATATTGTTCAAGAGTCAA No data
Right 999993942 5:157073952-157073974 AACTATATATATTTATTTGAGGG No data
999993938_999993942 5 Left 999993938 5:157073924-157073946 CCACTAGCCCTCATATTGTTCAA No data
Right 999993942 5:157073952-157073974 AACTATATATATTTATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999993942 Original CRISPR AACTATATATATTTATTTGA GGG Intergenic
No off target data available for this crispr