ID: 999993976

View in Genome Browser
Species Human (GRCh38)
Location 5:157074477-157074499
Sequence GTACAATGCTTGGCTTACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999993976_999993987 30 Left 999993976 5:157074477-157074499 CCACTGTAAGCCAAGCATTGTAC No data
Right 999993987 5:157074530-157074552 AGAGTTTACTTTCCAGTTGAGGG No data
999993976_999993986 29 Left 999993976 5:157074477-157074499 CCACTGTAAGCCAAGCATTGTAC No data
Right 999993986 5:157074529-157074551 TAGAGTTTACTTTCCAGTTGAGG No data
999993976_999993981 -4 Left 999993976 5:157074477-157074499 CCACTGTAAGCCAAGCATTGTAC No data
Right 999993981 5:157074496-157074518 GTACTAGGCCCCTGGGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999993976 Original CRISPR GTACAATGCTTGGCTTACAG TGG (reversed) Intergenic
No off target data available for this crispr