ID: 999998796

View in Genome Browser
Species Human (GRCh38)
Location 5:157118094-157118116
Sequence ATCTATGAGAATGTGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999998796_999998799 11 Left 999998796 5:157118094-157118116 CCATTCTGCACATTCTCATAGAT 0: 1
1: 0
2: 1
3: 22
4: 229
Right 999998799 5:157118128-157118150 CACAAATAGAGAAGCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999998796 Original CRISPR ATCTATGAGAATGTGCAGAA TGG (reversed) Intronic
904213196 1:28899120-28899142 ATCTATGAGACAGTGCACAGAGG - Intronic
905569097 1:38990332-38990354 ATATATGAGAAGGTACAGAAAGG + Intergenic
907300763 1:53485157-53485179 GTCTGTGAGAAGCTGCAGAAGGG + Intergenic
907674106 1:56502954-56502976 ATCCATGAGATTGTTCAGTATGG - Intronic
908504998 1:64787981-64788003 AGCTATGAGAAAATGGAGAACGG - Intronic
910344796 1:86224358-86224380 ATATATGAGAATGTTATGAATGG + Intergenic
910667677 1:89742189-89742211 ATCTCTGAGACTGGGGAGAAAGG + Intronic
911355550 1:96814302-96814324 ATTTCTGAGCATGTGCAGACTGG + Exonic
912011831 1:104976291-104976313 TTCTATTAGAATGTGAAGAAAGG + Intergenic
912253673 1:108037201-108037223 AACTATTAGGATCTGCAGAATGG + Intergenic
912478257 1:109956945-109956967 ATCTATGAGAGGCTGCAGATAGG - Intergenic
915296267 1:154923937-154923959 AACCATAGGAATGTGCAGAAGGG + Intergenic
917890213 1:179429755-179429777 ATCTATGGGAAGGTGAATAAAGG + Intronic
918304333 1:183232305-183232327 ATCTCTCAGAATGTCCTGAAGGG - Exonic
918552266 1:185756951-185756973 ATCTATGGGAAGCTGCTGAAAGG - Intronic
918731759 1:188006381-188006403 ATCTCTGAGAATGCACATAAGGG + Intergenic
919190923 1:194217828-194217850 ATCTATGAGATTTAGCAAAATGG + Intergenic
920755473 1:208726882-208726904 ATATATGAGAATGAGATGAAAGG + Intergenic
920755759 1:208729709-208729731 ATCTGTGAGAACTTGCAGGAAGG - Intergenic
923136273 1:231122972-231122994 ATCTCTGACCATGTGGAGAATGG - Intergenic
923323893 1:232863271-232863293 ATCTTTAAGAAGGTACAGAATGG + Intergenic
1062919851 10:1271542-1271564 ATCTGTGTGCATGTGCAGGAAGG - Intronic
1068247516 10:54391795-54391817 ATCTCTGAGAAGGTGAAGAGTGG + Intronic
1068501873 10:57849726-57849748 AATTATGCAAATGTGCAGAAGGG + Intergenic
1069203408 10:65652586-65652608 GTCTATGTGAATGTGCAGTGAGG + Intergenic
1069219840 10:65869359-65869381 AATTATGAAAATTTGCAGAAGGG - Intergenic
1070434962 10:76382460-76382482 ATTTATGAGAACCTGCTGAAAGG + Intronic
1070444726 10:76486017-76486039 ATCTATTAGAATATTCTGAAAGG - Intronic
1071343629 10:84670730-84670752 ATCTATGAGCAGGGGAAGAAGGG + Intergenic
1074227684 10:111503083-111503105 ATTTATGGAAATGTGCAGAGTGG + Intergenic
1079049659 11:17142844-17142866 ATATAAGAGAATGGGAAGAAAGG + Intronic
1082622963 11:55446425-55446447 ATCTATGAACATATGCAGACTGG - Intergenic
1082734077 11:56837345-56837367 AACTATGGGTATGTGCACAATGG + Intergenic
1083022139 11:59518030-59518052 ATCTATTAGAAGGTAAAGAAAGG + Intergenic
1084025161 11:66443485-66443507 ATCTATGTGCCTGTGCAGAGTGG - Intronic
1085762773 11:79256544-79256566 ATCAGTGAGAATCTGCAAAATGG + Intronic
1086221788 11:84454128-84454150 TTTTATGAGACTGTGCAGATGGG - Intronic
1087341033 11:96907445-96907467 ATTTATTAGATTGAGCAGAAAGG + Intergenic
1087547204 11:99599905-99599927 AGCTATAGGAATGTGGAGAAAGG + Intronic
1088164791 11:106921345-106921367 ATCCCTGGGAATATGCAGAAAGG - Intronic
1088685324 11:112280180-112280202 ATCTCTGAGAACCTGCAGGAAGG - Intergenic
1088778313 11:113108622-113108644 ATTTATGAGCATATGAAGAAAGG - Intronic
1091004134 11:131937062-131937084 AGCTATGAAAATGTGAAGAAAGG + Intronic
1091097806 11:132840440-132840462 ATGAATGAGAATGAGCAAAACGG - Intronic
1092776630 12:11949638-11949660 GCCTCTTAGAATGTGCAGAAAGG + Intergenic
1093323622 12:17745111-17745133 ATTTATGAGACTGTGGAGAGCGG - Intergenic
1095480186 12:42626481-42626503 TTCTTTGAAAATGTGCAGTAAGG - Intergenic
1097438036 12:59574663-59574685 AAATATGAGAATGTACAGCAAGG + Intergenic
1097503510 12:60436299-60436321 ATGTATGTGAATCTGCAAAATGG - Intergenic
1098800154 12:74946570-74946592 ATGGTTGAGTATGTGCAGAATGG - Intergenic
1099254767 12:80301971-80301993 ATCTGTGAAATTGTGAAGAAGGG - Intronic
1100021370 12:90073503-90073525 ATCTAGGAGCCTGTGCAGTAGGG + Intergenic
1101850350 12:108396990-108397012 ATCAATGAGAATGTTTAGAATGG + Intergenic
1103207904 12:119144426-119144448 AAGTTTGAGGATGTGCAGAAAGG + Intronic
1103434542 12:120914773-120914795 CTCAATGATAATCTGCAGAAGGG + Intergenic
1106903933 13:34385294-34385316 ATCTATGAGGAAATACAGAATGG - Intergenic
1107510785 13:41081935-41081957 ATCTATGAGACTCTGGAAAATGG - Intronic
1108105011 13:46999237-46999259 AATTATGAGAGTGTGCAGAAGGG - Intergenic
1108422747 13:50267329-50267351 ATTTCTGAAAATGTACAGAAAGG - Intronic
1109683099 13:65778720-65778742 ACCTATCAGATTGTGCAGATAGG - Intergenic
1109862121 13:68213499-68213521 ATGTATGAGAAAAGGCAGAAAGG - Intergenic
1110245254 13:73316068-73316090 ACTGATGAGAATGTGAAGAAAGG + Intergenic
1111405021 13:87793006-87793028 ACCTGTAAGAATGTGCAGCAGGG + Intergenic
1111718698 13:91913737-91913759 AACTCTGAGAATTTGCACAATGG - Intronic
1112395906 13:99031651-99031673 ATCGATGAAAATGTTCAGTAAGG + Intronic
1116476735 14:45348866-45348888 TTGTAAGAGAATGTGGAGAATGG - Intergenic
1117226390 14:53664760-53664782 ATCTATGTGTGTGTGCACAAGGG - Intergenic
1118238521 14:64034717-64034739 ATCTATAAAAATATGCAGTATGG - Intronic
1118542040 14:66839104-66839126 ATAGATGAGAATTAGCAGAAAGG + Intronic
1119341652 14:73884217-73884239 ATCTTTGAAAATATGCAAAATGG - Exonic
1120456750 14:84740441-84740463 ATCTATGAGATCATGCAGTAAGG + Intergenic
1121920571 14:97877150-97877172 AGCTATGCGAATGGTCAGAAGGG - Intergenic
1202833487 14_GL000009v2_random:60108-60130 ATCTATGTTCAAGTGCAGAAAGG + Intergenic
1124252588 15:28116787-28116809 ATCTGTGAGGAGCTGCAGAACGG - Exonic
1124859723 15:33427138-33427160 ATCCAGGAGGATATGCAGAAAGG + Intronic
1125134606 15:36327277-36327299 ATCTGTGAGAACCTGCAGACTGG - Intergenic
1126873482 15:53013353-53013375 ATCTGTGTGAATGTGCAGTATGG + Intergenic
1128414721 15:67434734-67434756 ATTGGTGAGAATGTGGAGAAAGG - Intronic
1130152378 15:81321016-81321038 AACAATGAAAATGTGGAGAAAGG - Intronic
1130200995 15:81826660-81826682 ATCTATGAGAAGGAACTGAATGG + Intergenic
1131371363 15:91884822-91884844 ATATATGAAAATATGCAGCATGG - Intronic
1132841299 16:1979602-1979624 AGCAAGGAGAATGTGGAGAAGGG - Exonic
1133229584 16:4360205-4360227 ATGTATGTGACTGTGGAGAAGGG + Intronic
1139430990 16:66910960-66910982 ATCTAGGAGAATGATCAGAGAGG + Intronic
1139700776 16:68706873-68706895 CTCTATGAGGAGGGGCAGAAGGG + Intronic
1139791189 16:69436848-69436870 ATAGAGGAGAATGTGAAGAATGG - Intronic
1140132411 16:72175205-72175227 ATCTATGAGATGGGGCAGAAGGG - Intronic
1140648702 16:77064002-77064024 ATCTCTGAAAACATGCAGAAGGG + Intergenic
1203141053 16_KI270728v1_random:1766200-1766222 ATCTATGTCAATGAGCAGAGAGG + Intergenic
1144315893 17:14060981-14061003 ATCTGTGAGAATGTTCTGACTGG + Intergenic
1147773564 17:42884552-42884574 GTCCATCAGAAGGTGCAGAAAGG + Intergenic
1149010349 17:51850205-51850227 TTCTATGAAAATATGCAGCATGG + Intronic
1149033827 17:52112820-52112842 ATCCATGAGAAAGGGCAGAAGGG - Intronic
1150623084 17:66822960-66822982 ACCTATGAGAATGGGCAAAATGG + Intergenic
1151203478 17:72487485-72487507 ATCTAAGAGAAGGTTGAGAACGG + Intergenic
1151500732 17:74486817-74486839 GTCTATGAAAATGTGCAAAATGG - Intergenic
1153327292 18:3833712-3833734 ATCTATGAGAATGCTCCAAAAGG - Intronic
1154991638 18:21602694-21602716 AACTATGGTAATGTGAAGAATGG - Intergenic
1156496069 18:37525834-37525856 CTCTATGAGACTGTGAACAAGGG - Intronic
1156773454 18:40758338-40758360 ATGTTTGAGAATTTGAAGAAAGG + Intergenic
1157443246 18:47725933-47725955 CACTATGAGAGTGTGCAGAAGGG - Intergenic
1157781238 18:50441026-50441048 ATCTGGGAGGATGTGCAGAAGGG + Intergenic
1158379263 18:56911012-56911034 CTCTATGAAAATCTGCAGCAGGG - Intronic
1159920829 18:74226107-74226129 ATCCATGGGAATGGGAAGAAAGG + Intergenic
1160061254 18:75531097-75531119 ATCTAGGAGGCTTTGCAGAATGG + Intergenic
1161855343 19:6761280-6761302 ACCTATAAGATTGTGCAGCAGGG - Intronic
1163137292 19:15321461-15321483 ATCTCTGACCATGTGCAGAATGG - Intronic
1202639185 1_KI270706v1_random:67587-67609 ATCTATGTTCAAGTGCAGAAAGG - Intergenic
926073277 2:9918724-9918746 CTTTATGAGAATGAGCAGCAAGG + Intronic
926341990 2:11911146-11911168 ATCAATGACAGTGTGCAGCAGGG + Intergenic
926651206 2:15348230-15348252 ATCTATTACAATTTGCTGAAAGG + Intronic
927637496 2:24826679-24826701 ATGTATGAGAATGTCCAAAGTGG - Intronic
929753292 2:44740022-44740044 ATCTATGGTAATGGGCAGGAAGG + Intronic
930446573 2:51481103-51481125 ATTGATGAGGATGTGAAGAAAGG + Intergenic
930775133 2:55163463-55163485 CTTTATGAGAATGTGCAGCTAGG - Intergenic
930953373 2:57172779-57172801 ATTTGTGAGGATGTGGAGAAAGG + Intergenic
931265275 2:60654815-60654837 TTCAATGAGAATGTCCAGACCGG + Intergenic
931704999 2:64939859-64939881 ATCCCTGAGAATGTGCTGGAGGG - Intergenic
931859828 2:66343306-66343328 AGCTGTGAGAATATGAAGAATGG + Intergenic
932735733 2:74252949-74252971 GTGTATGAGAATGGGCAGTAGGG - Intronic
932957431 2:76370074-76370096 ATCTATGAGGTTGTTCAGCATGG - Intergenic
933031582 2:77334993-77335015 AACTATGAGAATGTAGAGAGTGG - Intronic
933108400 2:78363036-78363058 ATCTATGAGATTTGGGAGAAAGG + Intergenic
933635505 2:84704387-84704409 AGCAATGAGAAGGTGGAGAAGGG - Intronic
934795798 2:97098052-97098074 ATCCATGAAATTGTGAAGAAGGG - Intergenic
936919027 2:117669061-117669083 ATCAATGAGGATGTGAGGAAAGG - Intergenic
937552748 2:123114339-123114361 ATCAATGAAAATGTGAAGCATGG + Intergenic
939375508 2:141360431-141360453 ACCTATGAAAATATACAGAATGG + Intronic
942224066 2:173799167-173799189 ATCTATCTGAATTTGGAGAAAGG - Intergenic
942738254 2:179141138-179141160 TTCTAAGAGAATATGTAGAAGGG - Intronic
942827769 2:180200624-180200646 ATGAATAAAAATGTGCAGAAAGG + Intergenic
942878652 2:180832837-180832859 CTCTCTGAGAATTTGCAGAGTGG - Intergenic
943469664 2:188278340-188278362 ATCTTTAAGAATTTGCATAACGG + Intergenic
944198684 2:197082559-197082581 ATATATGTGAATGTGCATATGGG + Intronic
944991676 2:205244824-205244846 ATCCATTTGAATGTGAAGAAGGG - Intronic
945424187 2:209679306-209679328 ATCTATGAGTAGGGGCAGCAAGG - Intronic
947455348 2:230249061-230249083 ATGTATGCGAATGTGAAGAAGGG - Intronic
1173396532 20:42685470-42685492 ATCTGTAAGAAGGGGCAGAATGG + Intronic
1175572393 20:60033952-60033974 TTCTATGAGAATTTATAGAAGGG - Intronic
1175586430 20:60144485-60144507 AGCTATGACTATGTGCAGACGGG - Intergenic
1176647508 21:9365196-9365218 ATCTATGTTCAAGTGCAGAAAGG - Intergenic
1177059966 21:16359435-16359457 TTTGATGAGAATGTGGAGAAGGG - Intergenic
1177559470 21:22731157-22731179 ATCTATTAGAATATGCAAAGAGG + Intergenic
1177569856 21:22873212-22873234 ATCTATGAGAATTTGGGGGAAGG + Intergenic
1177678972 21:24339170-24339192 ATCTGTAAAAATGTGCAGATGGG - Intergenic
1178709429 21:34901622-34901644 ACCAAAGAGAATGTGGAGAAGGG - Intronic
1180362765 22:11914277-11914299 ATCTATGTTCATGTGTAGAAAGG + Intergenic
1182835947 22:33341430-33341452 ATCTATGAGAGTCTGCAGCAGGG + Intronic
949126910 3:456450-456472 AACTATGGGAATGAGCATAAAGG + Intergenic
949389755 3:3545951-3545973 AACTAAGAGAATGTGCAGTACGG - Intergenic
950255855 3:11505209-11505231 TGCTATGAGAATGGGCAGACTGG + Intronic
951192141 3:19783470-19783492 ATGTAAGAGACTGTGCAGTAGGG + Intergenic
952679848 3:36078857-36078879 ATCTTTGAGAATAAGCACAAAGG - Intergenic
954745221 3:52783964-52783986 AACTGTGGGCATGTGCAGAATGG + Intronic
955402315 3:58601366-58601388 ATCTTTTAGAAAGTGCAGATGGG + Intronic
957039283 3:75324518-75324540 ATCTATGTAAATGCACAGAAAGG - Intergenic
957120080 3:76078870-76078892 GTTGATGAGAATGTGGAGAAAGG - Intronic
957531785 3:81450044-81450066 ATCTATAACAATAGGCAGAAAGG + Intergenic
958945265 3:100354923-100354945 ATCAATGAGAAGGGGCATAAAGG - Intronic
959905866 3:111710716-111710738 ATCTCAGAGAATTAGCAGAATGG + Intronic
961436516 3:126922517-126922539 ATCTCTCAGAATGTACAGGATGG + Intronic
962271712 3:133982336-133982358 GCCTATGAGCAGGTGCAGAATGG - Intronic
966646172 3:182248218-182248240 ATGTATAAGAATGTGGATAAAGG + Intergenic
967172381 3:186831845-186831867 ATCTATGAAAATGTCCATACTGG + Intergenic
967459613 3:189730277-189730299 AACATTGAGAATCTGCAGAAGGG + Intronic
967799135 3:193635002-193635024 ATCTAAAATAATGTGAAGAAAGG + Intronic
1202739371 3_GL000221v1_random:39791-39813 ATCTATGTTCAAGTGCAGAAAGG + Intergenic
968771016 4:2507144-2507166 ATTTATGAGACTCTGTAGAAAGG + Intronic
971089734 4:23327407-23327429 ATCTATGAAAAGGTTCAGAGGGG - Intergenic
973391612 4:49561469-49561491 ATCTATGTTCAAGTGCAGAAAGG + Intergenic
973718711 4:53702516-53702538 AGCTAAGGGGATGTGCAGAAAGG + Intronic
975451066 4:74527388-74527410 ATCTGTGAGTCTCTGCAGAATGG + Intergenic
975775481 4:77782085-77782107 TTATATGAGAATGTGTAAAATGG - Intronic
976303231 4:83535353-83535375 ATTTTTAAGAATGAGCAGAAGGG - Intergenic
976400575 4:84602135-84602157 AACTATGAGAATGAGTAGCAGGG - Intronic
978478225 4:109156865-109156887 ATCTTTGAGAATGTAATGAAAGG - Intronic
984446431 4:179842485-179842507 ATTTATGATAATGAGCAGTAGGG + Intergenic
1202766535 4_GL000008v2_random:153457-153479 ATCTATGTTCAAGTGCAGAAAGG - Intergenic
988141249 5:27243766-27243788 ATGTGTGAGAATGTGTAGAGGGG + Intergenic
988733339 5:33995432-33995454 ATTCATGAGATTGTGAAGAAGGG + Intronic
989139410 5:38188570-38188592 AGTTATGAAAATATGCAGAAAGG - Intergenic
989145295 5:38243434-38243456 ATATATGAAAAAGTGTAGAACGG - Intergenic
990086943 5:51990263-51990285 CTCAATGAGAATGTAAAGAAAGG - Intergenic
992718599 5:79536123-79536145 AGACATCAGAATGTGCAGAAAGG + Intergenic
995660850 5:114481411-114481433 ATCTATGAGCATGGGCAGTATGG - Intronic
996098384 5:119422696-119422718 ATTTAGGATAATTTGCAGAATGG + Intergenic
996888043 5:128382629-128382651 ATGTATAAGAAGGTGCAGATTGG - Intronic
997439379 5:133898655-133898677 GTCGGTGAGACTGTGCAGAAAGG - Intergenic
998107612 5:139478277-139478299 ATCTATGAGCTTCTGGAGAACGG - Exonic
998245741 5:140502832-140502854 ACCTATAAGAATATGCAAAATGG - Intronic
999431698 5:151530625-151530647 ATTTATGAGAATCTGAAAAATGG + Intronic
999725554 5:154434337-154434359 ATTTATGTAAATGTCCAGAAAGG - Intergenic
999812849 5:155144280-155144302 ATCTCTGAGAATCAGTAGAAGGG - Intergenic
999998796 5:157118094-157118116 ATCTATGAGAATGTGCAGAATGG - Intronic
1000474040 5:161683154-161683176 ATTTCTGACAATCTGCAGAATGG + Intronic
1000474891 5:161694348-161694370 ATCTATGAGCATATTCAAAATGG - Intronic
1001002175 5:168017947-168017969 AGCTATGAGAAAGAGCAGATGGG - Intronic
1001593030 5:172879398-172879420 TTCCATGAGAATGTACAGGAAGG - Intronic
1001906242 5:175475982-175476004 ATCTAAGAGAATGTGGATTAAGG - Intergenic
1002366779 5:178718940-178718962 ATTTAAGAGAATGTGCAGCCTGG - Intronic
1002476766 5:179470910-179470932 ATGTTTGAGAATGAGAAGAAGGG - Intergenic
1005352559 6:24950596-24950618 ATCTAAGTGAATGGGCAGTAGGG + Intronic
1005983733 6:30857050-30857072 ACCTATGGGAATGTGCAAATGGG + Intergenic
1007268062 6:40612115-40612137 ATCTTTGAGGATGGCCAGAATGG + Intergenic
1009063077 6:58420239-58420261 ATAAATGTGAATTTGCAGAATGG + Intergenic
1012969190 6:105708397-105708419 ATTTATAAGAATGTAGAGAATGG - Intergenic
1013723174 6:113056503-113056525 ACCTATCAGAATGGGCAAAATGG - Intergenic
1013973834 6:116052956-116052978 ATAAATGAGACTGTGCAGAAAGG - Intronic
1014121411 6:117729577-117729599 GTCTATTAGAATGTCCAAAATGG + Intergenic
1016776639 6:147911625-147911647 ATCTCCTAGAATGTGCAAAAGGG - Intergenic
1021783277 7:24127693-24127715 ATCTGTGAGAAGGTGAAGGAGGG - Intergenic
1023091664 7:36623610-36623632 TTCTATAACAATGTGCAAAATGG - Intronic
1023344265 7:39254972-39254994 ATCTAAGAGAATGTAAATAATGG + Intronic
1023476649 7:40586430-40586452 TGCTCTAAGAATGTGCAGAATGG + Intronic
1032361797 7:131262887-131262909 ATGTATGTGAGTGTGGAGAAAGG - Intronic
1032636295 7:133712880-133712902 ATCTATATGAATATCCAGAATGG + Intronic
1032662900 7:134005349-134005371 ATTTGAGAGAATGTGCAGACTGG + Intronic
1038875217 8:31541076-31541098 CTCTATGATAATGACCAGAAAGG + Intergenic
1038923979 8:32117229-32117251 ATCTATGAGAATGTTTCAAAGGG + Intronic
1040797507 8:51302312-51302334 ATCCATGAGAGTTTGCAGAGGGG + Intergenic
1043820046 8:84852128-84852150 AACTATGTGAATATGCACAATGG + Intronic
1045316791 8:101050125-101050147 AGCTATGAAAATGTGAAGATGGG + Intergenic
1046624406 8:116561459-116561481 ATCTCTGAGAATATGCAGACAGG - Intergenic
1048108533 8:131440391-131440413 ATCTAAGAGGATTTGCAGATTGG - Intergenic
1050430209 9:5554449-5554471 ATTTATGAGAATGAGTAGAAAGG - Intronic
1050948108 9:11551026-11551048 TTCTATGAAATTGTGAAGAAGGG - Intergenic
1052596183 9:30561109-30561131 ATCTAAGGGAATGAGGAGAATGG - Intergenic
1055376446 9:75653849-75653871 ATCAATAAGACTTTGCAGAACGG + Intergenic
1056374682 9:85996037-85996059 AACCATGAGATTGTGAAGAAAGG - Intronic
1057165696 9:92923696-92923718 ATCTAGGAGAATCTGCAGAGAGG + Intergenic
1057748792 9:97773297-97773319 AGCTCTGAGAATGGGCAGACTGG - Intergenic
1058033103 9:100221263-100221285 ATCTTTGGGAATGAGCAGAAGGG - Intronic
1058370850 9:104265827-104265849 ATCTATGGACATGTGCAGAGTGG + Intergenic
1061644236 9:131987168-131987190 CTCTTTGAGAACGTGCAGCAAGG - Intronic
1062276504 9:135733836-135733858 CACTTTGAGAATGTCCAGAATGG + Intronic
1062539901 9:137036953-137036975 ACCTAAGAGAATGGGCAGCAGGG + Exonic
1203708014 Un_KI270742v1:69740-69762 ATCTATGTTCAAGTGCAGAAAGG + Intergenic
1203547290 Un_KI270743v1:138335-138357 ATCTATGTTCAAGTGCAGAAAGG - Intergenic
1186810930 X:13187861-13187883 ATCAATGAGAAGGGGAAGAAGGG - Intergenic
1187107630 X:16260616-16260638 TGCTATGGGAATGTGGAGAAGGG + Intergenic
1189646487 X:43138399-43138421 AACAATGAGAATATGCTGAAGGG + Intergenic
1193047729 X:77069993-77070015 ATCTCTGAGCCTCTGCAGAAAGG - Intergenic
1193199199 X:78667671-78667693 CTCTATCAGCATGTGCAAAAGGG + Intergenic
1193573109 X:83169065-83169087 ATTGGTGAGAATGTGTAGAAAGG - Intergenic
1194196864 X:90904756-90904778 AGCTTTGAGAATGTCAAGAAAGG + Intergenic
1195078745 X:101351487-101351509 ATCACAGAGAAAGTGCAGAAAGG - Intronic
1196211215 X:112997765-112997787 CTATATGAGAATGTGAAGGAGGG + Intergenic
1196795916 X:119501820-119501842 ATCTATGTGGAAGTGCAGCAAGG - Intergenic
1199273553 X:145914613-145914635 ATCTATGAGAACCTATAGAACGG + Intergenic
1199394623 X:147320760-147320782 ATCTATCAGAATCTCCTGAAGGG + Intergenic
1199902732 X:152193123-152193145 ACTTATGAGAAAGGGCAGAAAGG - Intronic
1200419109 Y:2944523-2944545 ATCTATGAGACTGTGCAGATAGG - Intronic
1200542713 Y:4478962-4478984 AGCTTTGAGAATGTCAAGAAAGG + Intergenic