ID: 1000041255_1000041263

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1000041255 1000041263
Species Human (GRCh38) Human (GRCh38)
Location 5:157486704-157486726 5:157486748-157486770
Sequence CCTGTTCTCCTGTAACCCCAAGT CTTTCTTTCATCTCTCTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 153} {0: 1, 1: 0, 2: 3, 3: 62, 4: 645}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!