ID: 1000052650_1000052662

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1000052650 1000052662
Species Human (GRCh38) Human (GRCh38)
Location 5:157575807-157575829 5:157575843-157575865
Sequence CCCGGCTCCCAGCCCTCTGCCGA CAGCCCCGCGGGCCTCCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 438} {0: 1, 1: 0, 2: 2, 3: 47, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!