ID: 1000220460_1000220473

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1000220460 1000220473
Species Human (GRCh38) Human (GRCh38)
Location 5:159209309-159209331 5:159209340-159209362
Sequence CCTCCCGTTCTCCTCGGGCGGCG CGGTACGGCACGGCTCACAGCGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 71} {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!