ID: 1000298975_1000298980

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1000298975 1000298980
Species Human (GRCh38) Human (GRCh38)
Location 5:159937960-159937982 5:159937981-159938003
Sequence CCCACTGGAGGCCAAAGCTTCCC CCACACCTCAGTGCTCTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 151} {0: 1, 1: 2, 2: 6, 3: 25, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!