ID: 1000334035_1000334037

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1000334035 1000334037
Species Human (GRCh38) Human (GRCh38)
Location 5:160228766-160228788 5:160228794-160228816
Sequence CCTTCAAGTTTGCTTTGCTCCAG CTCATTGTTTCCTTTCATCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 33, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!