ID: 1000342274_1000342278

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1000342274 1000342278
Species Human (GRCh38) Human (GRCh38)
Location 5:160287035-160287057 5:160287059-160287081
Sequence CCCACATACCGGGGATTAGCTTG TACCTACAGAGTGTGAGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44} {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!