ID: 1000342274_1000342281

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1000342274 1000342281
Species Human (GRCh38) Human (GRCh38)
Location 5:160287035-160287057 5:160287069-160287091
Sequence CCCACATACCGGGGATTAGCTTG GTGTGAGGTCAGGCAGTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44} {0: 1, 1: 0, 2: 3, 3: 21, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!