ID: 1000352276_1000352285

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1000352276 1000352285
Species Human (GRCh38) Human (GRCh38)
Location 5:160361283-160361305 5:160361315-160361337
Sequence CCAAGGGCCCTCTGCCCAGACTG AGGTGCCAAAAGTGGGGACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 321} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!