ID: 1000382597_1000382606

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1000382597 1000382606
Species Human (GRCh38) Human (GRCh38)
Location 5:160642480-160642502 5:160642531-160642553
Sequence CCAGAGGACATTTGGCAACGTCT GGGGGTGCTAATGCATCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 50, 2: 320, 3: 772, 4: 1278} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!