ID: 1000470983_1000470988

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1000470983 1000470988
Species Human (GRCh38) Human (GRCh38)
Location 5:161641606-161641628 5:161641654-161641676
Sequence CCTACTCATGTATCACCATCACC GATTTGGTCATAGAACACCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 3, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!