ID: 1000621246_1000621249

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1000621246 1000621249
Species Human (GRCh38) Human (GRCh38)
Location 5:163489234-163489256 5:163489247-163489269
Sequence CCTGGCTCACCACTTACCTCCTG TTACCTCCTGCTCTGCAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 51, 4: 373} {0: 2, 1: 33, 2: 326, 3: 597, 4: 1179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!