ID: 1000621257_1000621261

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1000621257 1000621261
Species Human (GRCh38) Human (GRCh38)
Location 5:163489272-163489294 5:163489290-163489312
Sequence CCTAACAGGCCTTGGATGGGTAT GGTATTGGTCTGTAGCCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 72, 4: 371} {0: 1, 1: 0, 2: 10, 3: 97, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!