ID: 1000833739_1000833746

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1000833739 1000833746
Species Human (GRCh38) Human (GRCh38)
Location 5:166132005-166132027 5:166132031-166132053
Sequence CCCGTTTTAGCTGGGAGGTGTGC CTGAAGGAGTTGGTAAATAAGGG
Strand - +
Off-target summary No data {0: 11, 1: 4, 2: 4, 3: 20, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!