ID: 1000950236_1000950239

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1000950236 1000950239
Species Human (GRCh38) Human (GRCh38)
Location 5:167472835-167472857 5:167472857-167472879
Sequence CCACATGGACTCATACACTTCAG GGAAGCCAAAAGACCTAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 10, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!